ENG Database

  • Reference sequences were NC_000009.10 and NM_001114753.1. cDNA #1 is the "A" of the start codon.
  • Frameshift is noted by original amino acid and codon number followed by "fs" (ex. Leu159fs).
  • Click any Column Header to sort the display. See Comments for additional variant information.
  • "Live Search" any term in the search box, such as "exon" , "missense", "benign" , "2010" , etc...
  • Clinical features/diagnostic criteria are: epistaxis (E), telangiectasia oral/dermal (T), pulmonary AVM (P), cerebral AVM (C), hepatic involvement (H), GI telangiectasia (G) and family history (F).

Click for a detailed description of Classification


470 variants found

( *Independent Observations )

Genomic Position Location Mutation
Type
Nucleotide
Change
Protein
Change
Classification Ind * Obs References Comments
130577292 5'UTR Regulatory c.-9G>A Pathogenic 4 Gedge (2007)
ARUP Laboratories
130577292 5'UTR Regulatory c.-10C>T Pathogenic 3 Bossler (2006)
ARUP Laboratories
130577292 Exon 1 Large Deletion c.-?_67+?del Deletion Exon 1 Pathogenic 2 Lesca (2006)
Bossler (2006)
130577292 Exon 1 Large Deletion c.-?_360+?del Deletion Exon 1 Pathogenic 1 ARUP Laboratories
130577292 Exon 1 Large Deletion EX1del Deletion Exon 1 Pathogenic 1 ARUP Laboratories
130577292 Exon 1 Missense c.1A>G p.Met1Val Pathogenic 3 Letteboer (2005)
Lenato (2006)
Gedge (2007)
130577293 Exon 1 Missense c.2T>C p.Met1Thr 4 Gallione (1998)
Cymerman (2000)
Bayrak-Toydemir (2006)
Giordano (2006)
 
130577293 Exon 1 Missense c.2T>G p.Met1Arg Pathogenic 4 Lesca (2004)
Berg (2003)
Lastres (1994)
ARUP Laboratories
130577294 Exon 1 Missense c.3G>A p.Met1Ile 1 ARUP Laboratories  
130577298 Exon 1 Missense c.7C>T p.Arg3Cys 1 ARUP Laboratories  
130577305 Exon 1 Missense c.14C>T p.Thr5Met Benign 9 Shovlin (1997)
Lastella (2003)
Abdalla (2005)
Lenato (2006)
ARUP Laboratories
130577314 Exon 1 Missense c.23T>C p.Leu8Pro Pathogenic 5 Lesca (2004)
Kjeldsen (2005)
Olivieri (2006)
El-Harith (2006)
ARUP Laboratories
130577323 Exon 1 Missense c.32C>A p.Ala11Asp 1 Bossler (2006)  
130577325 Exon 1 Insertion/Frameshift c.34_35insGGCTGTTGCCC p.Leu12fs Pathogenic 2 Bayrak-Toydemir (2006)
Gedge (2007)
130577326 Exon 1 Missense c.35T>C p.Lys12Pro Uncertain 2 ARUP Laboratories
130577326 Exon 1 Missense c.35T>G p.Leu12Arg 1 ARUP Laboratories  
130577332 Exon 1 Insertion/Frameshift c.41_51dupTGGCCAGCTGC p.Ser18fsX46 Pathogenic 1 Gedge (2007)
130577332 Exon 1 Missense c.41T>C p.Leu14Pro Pathogenic 1 ARUP Laboratories
130577354 Exon 1 Deletion/Frameshift c.63delC p.Thr22fs Pathogenic 4 Lastella (2003)
Abdalla (2005)
Lenato (2006)
Giordano (2006)
130577358 Exon 1 Deletion/Frameshift c.67delA p.Ser23fs Pathogenic 2 ARUP Laboratories
130577358 Intron 1 Splice Defect c.67+14C>T Benign 1 ARUP Laboratories
130577358 Intron 1 Splice Defect c.67+1G>A Pathogenic 3 Gallione (2000)
Letteboer (2005)
Giordano (2006)
130577358 Intron 1 Splice Defect c.67+3A>T 1 Bossler (2006)  
130577358 Intron 1 Splice Defect c.67+5G>A Pathogenic 1 Prigoda (2006)
130577358 Intron 1 Splice Defect c.67+25G>T Uncertain 2 Lastella (2003)
Lenato (2006)
130577358 Intron 1 Splice Defect c.67+2delT Pathogenic 2 ARUP Laboratories
130577359 Intron 1 Splice Defect c.68-1G>A Pathogenic 2 Lesca (2004)
Bossler (2006)
130577359 Intron 1 Intronic SNV c.68-18C>A Benign 1 Bossler (2006)
130577359 Intron 1 Splice Defect c.68G>A p.Ser23fs Pathogenic 3 Shovlin (1997)
Fernandez (2005)
Fernandez (2006)
130577359 Exon 2-4 Large Duplication c.68-?_523+?dup Duplication Exons 2-4 Pathogenic 1 Prigoda (2006)
130577359 Exon 2-8 Large Duplication EX2_8dup Duplication Exon 2-8 Pathogenic 1 ARUP Laboratories
130577359 Exon 2-9 Large Deletion c.68-?_?del Deletion Exon 2-9 Pathogenic 1 Bossler (2006)
130577359 Exon 2-10 Large Deletion EX2_10 Deletion Exon 2-10 Pathogenic 1 Bossler (2006)
130577368 Exon 2 Deletion/Frameshift c.77delA p.Glu26fs Pathogenic 1 Olivieri (2007)
130577381 Exon 2 Nonsense c.90T>A p.Cys30X Pathogenic 1 Berg (2003)
130577386 Exon 2 Missense c.95T>A p.Leu32His Pathogenic 2 Gedge (2007)
ARUP Laboratories
130577386 Exon 2 Missense c.95T>G p.Leu32Arg 5 Paquet (2001)
Lin (2000)
Bossler (2006)
Giordano (2006)
Gedge (2007)
 
130577387 Exon 2 Deletion/Frameshift c.96_102delTCAGCCT p.Leu32fs Pathogenic 1 Olivieri (2007)
130577388 Exon 2 Nonsense c.97C>T p.Gln33X Pathogenic 2 Lenato (2006)
Olivieri (2007)
130577398 Exon 2 Deletion/Frameshift c.107delG p.Gly36fs Pathogenic 1 Schulte (2005)
130577402 Exon 2 Deletion/Frameshift c.111delC p.Pro37fs Pathogenic 1 ARUP Laboratories
130577406 Exon 2 Deletion/Frameshift c.115delA p.Arg39fs Pathogenic 2 Cymerman (2003)
ARUP Laboratories
130577411 Exon 2 Silent c.120C>T p.Gly40Gly Benign 7 ARUP Laboratories
130577412 Exon 2 Nonsense c.121G>T p.Glu41X Pathogenic 1 Cymerman (2003)
130577433 Exon 2 Nonsense c.142C>T p.Gln48X Pathogenic 1 Letteboer (2005)
130577436 Exon 2 Missense c.145G>T p.Val49Phe Pathogenic 3 Lesca (2004)
Olivieri (2007)
ARUP Laboratories
130577445 Exon 2 Missense c.154G>C p.Gly52Arg 1 Wehner (2006)  
130577446 Exon 2 Missense c.155G>A p.Gly52Asp 3 Paquet (2001)
Harrison (2003)
Wehner (2006)
 
130577446 Exon 2 Missense c.155G>T p.Gly52Val 6 Pece (1997)
Gallione (1998)
Pece-Barbara (1999)
McDonald(2000)
 
130577448 Exon 2 Missense c.157T>C p.Cys53Arg Pathogenic 4 Gallione (1998)
Pece-Barbara (1999)
Cymerman (2000)
Bayrak-Toydemir (2004)
Karabegovic (2004)
Bayrak-Toydemir (2006)
130577450 Exon 2 Nonsense c.159C>A p.Cys53X Pathogenic 1 Letteboer (2005)
130577455 Exon 2 Deletion/Frameshift c.164delC Unknown Pathogenic 1 ARUP Laboratories
130577457 Exon 2 Nonsense c.166C>T p.Gln56X Pathogenic 3 Bossler (2006)
Argyriou(2006)
ARUP Laboratories
130577470 Exon 2 Missense c.179-180CC>AA p.Ala60Glu Uncertain 2 ARUP Laboratories
130577486 Exon 2 Insertion/Frameshift c.195_196dupT p.His65fs Uncertain 4 Lesca (2004)
Schulte (2005)
Lesca (2006)
Yan(2006)
130577498 Exon 2 Silent c.207G>A p.Leu69Leu Benign 19 Shovlin (1997)
Lastella (2003)
Lesca (2004)
Lenato (2006)
ARUP Laboratories
130577501 Exon 2 Deletion/Frameshift c.210delG p.Leu69fs Pathogenic 1 Olivieri (2007)
130577503 Exon 2 Insertion/Frameshift c.212_219+6del14bp p.Phe71fs Pathogenic 1 ARUP Laboratories
130577505 Exon 2 Deletion/Frameshift c.214_215delCC p.Pro72fs Pathogenic 1 ARUP Laboratories
130577510 Exon 2 Splice Site/Silent c.219G>A p.Thr73Thr Uncertain 3 Cymerman (2003)
Kuehl (2005)
Gedge (2007)
130577510 Intron 2 Intronic SNV c.219+22_23CG>GA Benign 1 ARUP Laboratories
130577510 Intron 2 Intronic SNV c.219+25 G>T Benign 1 ARUP Laboratories
130577510 Intron 2 Intronic Indel c.219+22-23delCGinsGA Benign 1 Gedge (2007)
130577510 Intron 2 Intronic SNV c.219+22C>T Benign 1 Bossler (2006)
130577510 Intron 2 Intronic SNV c.219+25G>A Benign 1 Gedge (2007)
130577510 Intron 2 Intronic SNV c.219+25G>T Benign 1 ARUP Laboratories
130577510 Intron 2 Splice Defect ? c.219+5G>A 1 ARUP Laboratories  
130577510 Intron 2 Splice Defect ? c.219+5G>C 1 Lesca (2006)  
130577511 Intron 2 Splice Defect c.220-2A>G Pathogenic 1 ARUP Laboratories
130577511 Exon 3 Large Deletion c.220-?_360+?del Deletion Exon 3 Pathogenic 1 Bossler (2006)
130577511 Exon 3 Large Deletion EX3del Deletion Exon 3 Pathogenic 1 ARUP Laboratories
130577511 Exon 3 Large Duplication EX3dup Duplication Exon 3 Pathogenic 2 ARUP Laboratories
130577511 Exon 3-4 Large Deletion EX3_4del Deletion Exon 3-4 Pathogenic 1 ARUP Laboratories
130577511 Exon 3-8 Large Deletion EX3_8del Deletion Exon 3-8 Pathogenic 1 ARUP Laboratories
130577515 Exon 3 Deletion/Frameshift c.224delC p.Pro75fs Pathogenic 1 ARUP Laboratories
130577516 Exon 3 Silent c.225G>A p.Pro75Pro Benign 2 ARUP Laboratories
130577520 Exon 3 Nonsense c.229C>T p.Gln77X Pathogenic 8 Lastella (2003)
Brusgaard (2004)
Abdalla (2003)
Bayrak-Toydemir (2004)
Zhang (2004)
Dakeishi (2002)
Sanz-Rodriguez (2004)
Lenato (2006)
Prigoda (2006)
130577525 Exon 3 Silent c.234G>A p.Leu78Leu Benign 1 ARUP Laboratories
130577538 Exon 3 Nonsense c.247C>T p.Gln83X Pathogenic 1 Letteboer (2005)
130577549 Exon 3 Insertion/Frameshift c.258_276dup
CAAAATGGCACCTGGCCC
p.Lys85_Gln86
dupQNGTWP
Uncertain 1 Brusgaard (2004)
130577564 Exon 3 Nonsense c.273_274GC>AA p.Trp91X Pathogenic 2 ARUP Laboratories
130577568 Exon 3 Nonsense c.277C>T p.Arg93X Pathogenic 9 Cymerman (2000)
Letteboer (2005)
Brusgaard (2004)
Bossler (2006)
Lesca (2006)
Olivieri (2006)
Gedge (2007)
Olivieri (2007)
ARUP Laboratories
130577568 Exon 3 Deletion/Frameshift c.277delC p.Arg93fs Pathogenic 1 Schulte (2005)
130577578 Exon 3 Missense c.287T>C p.Leu96Pro Pathogenic 1 Lenato (2006)
130577581 Exon 3 Missense c.290T>G p.Leu97Arg Pathogenic 3 Gedge (2007)
ARUP Laboratories
130577589 Exon 3 Deletion/Frameshift c.298_299delAG p.Ser100CysfsX48 Pathogenic 1 ARUP Laboratories
130577596 Exon 3 Deletion/Frameshift c.305delA p.Asn102ThrfsX61 Pathogenic 1 ARUP Laboratories
130577600 Exon 3 Deletion/Inframe c.309_311delCAG p.Ser104del Pathogenic 1 Lenato (2006)
130577605 Exon 3 Missense c.314T>A p.Val105Asp 1 Bossler (2006)  
130577611 Exon 3 Missense c.320T>G p.Leu107Arg 1 Lesca (2004)  
130577615 Exon 3 Insertion/Frameshift c.324dupT p.Leu109fs Pathogenic 1 Schulte (2005)
130577617 Exon 3 Deletion/Frameshift c.326_327delTC p.Leu109fs Pathogenic 1 Wehner (2006)
130577622 Exon 3 Missense c.331G>A p.Ala111Thr Suspected Pathogenic 1 ARUP Laboratories
130577623 Exon 3 Deletion/Frameshift c.332_338delCCCTGGG p.Ala111fs Pathogenic 1 Letteboer (2005)
130577629 Exon 3 Deletion/Frameshift c.338delG p.Leu112fs Pathogenic 1 Olivieri (2007)
130577635 Exon 3 Deletion/Frameshift c.344delC p.Pro115fs Pathogenic 1 Argyriou(2006)
130577651 Exon 2 Splice Defect c.360+4_7delAGTG Pathogenic 1 ARUP Laboratories
130577651 Exon 3 Splice Defect c.360+1G>A p.G74_Y120del Pathogenic 8 Pece (1997)
Cymerman (2000)
Cymerman (2003)
Letteboer (2005)
Bayrak-Toydemir (2004)
Schulte (2005)
Bayrak-Toydemir (2006)
Bossler (2006)
Olivieri (2007)
130577651 Exon 3 Nonsense c.360C>A p.Tyr120X Pathogenic 3 Brusgaard (2004)
Kjeldsen (2005)
ARUP Laboratories
130577651 Exon 3 Silent c.360C>T p.Tyr120Tyr Benign 1 ARUP Laboratories
130577651 Intron 3 Splice Defect c.360+1G>C p.Gly74_Tyr120del Pathogenic 1 Dakeishi (2002)
130577651 Intron 3 Splice Defect c.360+4A>G Pathogenic 1 Shovlin (1997)
130577651 Intron 3 Splice Defect ? c.360+5G>A Uncertain 1 ARUP Laboratories
130577651 Intron 3 Splice Defect ? c.360+5G>C Uncertain 2 Letteboer (2005)
Gedge (2007)
130577651 Intron 3 Intronic SNV c.360+91C>T Benign 2 ARUP Laboratories
130577651 Intron 3 Intronic SNV c.360+21C>T Benign 1 ARUP Laboratories
130577652 Intron 3 Large Duplication c.361-?_1134+?dup Pathogenic 1 ARUP Laboratories
130577652 Intron 3 Large Deletion c.361-?_523+?del Deletion Exon 4 Pathogenic 1 Bossler (2006)
130577652 Intron 3 Deletion/Frameshift c.361-113_109delTTCT Pathogenic 1 Bossler (2006)
130577652 Intron 3 Splice Defect c.361-2A>C Pathogenic 1 Kjeldsen (2005)
130577652 Intron 3 Splice Defect c.361-2A>G Pathogenic 2 Shovlin (1997)
Brusgaard (2004)
130577652 Exon 4-6 Large Deletion c.361-?_816+?del Deletion Exon 4-6 Pathogenic 1 Bossler (2006)
130577652 Exon 4-7 Large Deletion EX4_7del Deletion Exon 4-7 Pathogenic 1 ARUP Laboratories
130577665 Exon 4 Missense c.374T>A p.Val125Asp Uncertain 2 Paquet (2001)
Bossler (2006)
130577665 Exon 4 Missense c.374T>C p.Val125Ala Uncertain 1 ARUP Laboratories
130577679 Exon 4 Missense c.388C>A p.Pro130Ser Uncertain 1 Lenato (2006)
130577683 Exon 4 Missense c.392C>T p.Pro131Leu Pathogenic 6 Cymerman (2003)
Letteboer (2005)
Abdalla (2005)
Brusgaard (2004)
Kjeldsen (2005)
Fernandez (2006)
ARUP Laboratories
130577683 Exon 4 Deletion/Frameshift c.392delC p.Pro131fs Pathogenic 1 Wehner (2006)
130577713 Exon 4 Deletion/Frameshift c.422delT Pathogenic 1 ARUP Laboratories
130577737 Exon 4 Missense c.446G>C p.Trp149Ser Uncertain 2 Gedge (2007)
ARUP Laboratories
130577738 Exon 4 Nonsense c.447G>A p.Trp149X Uncertain 1 Bossler (2006)
130577738 Exon 4 Missense c.447G>C p.Trp149Cys Pathogenic 4 Gallione (1998)
Bourdeau (2000)
Bossler (2006)
ARUP Laboratories
130577752 Exon 4 Deletion/Frameshift c.461delG p.Gly154fs Pathogenic 1 Lesca (2004)
130577762 Exon 4 Deletion/Frameshift c.471_472delCT p.Ser158fs Pathogenic 3 Gedge (2007)
ARUP Laboratories
130577770 Exon 4 Missense c.479C>A p.Ala160Asp 1 Yamaguchi (1997)
Paquet (2001)
 
130577784 Exon 4 Missense c.493C>T p.Pro165Ser Uncertain 1 ARUP Laboratories
130577785 Exon 4 Missense c.494C>G p.Pro165Arg Uncertain 2 Gedge (2007)
ARUP Laboratories
130577785 Exon 4 Missense c.494C>T p.Pro165Leu Uncertain 1 Cymerman (2003)
130577786 Exon 4 Deletion/Frameshift c.495_496delCC p.Pro165fs Pathogenic 1 Olivieri (2007)
130577787 Exon 4 Deletion/Frameshift c.496delC p.Gln166fs Pathogenic 3 Lesca (2004)
ARUP Laboratories
130577787 Exon 4 Insertion/Frameshift c.496dupC p.Gln166fs Pathogenic 1 Schulte (2005)
130577788 Exon 4 Insertion/Frameshift c.497_498insC p.Gln166fs Pathogenic 2 Letteboer (2005)
ARUP Laboratories
130577802 Exon 4 Nonsense c.511C>T p.Arg171X Pathogenic 11 Shovlin (1997)
Lastella (2003)
Lesca (2004)
Berg (2003)
Fernandez (2005)
Sanz-Rodriguez (2004)
Lenato (2006)
Bayrak-Toydemir (2006)
Fernandez (2006)
Bossler (2006)
ARUP Laboratories
130577814 Exon 4 Missense c.523G>A p.Ala175Glu Pathogenic 1 Bossler (2006)
130577814 Exon 4 Splice Site/Missense c.523G>C p.Ala175Pro Pathogenic 1 Cymerman (2003)
130577815 Intron 4 Splice Defect c.524-1G>A Pathogenic 3 ARUP Laboratories
130577815 Intron 4 Splice Defect c.524-2A>G Pathogenic 5 Gallione (1998)
Bayrak-Toydemir (2006)
Gedge (2007)
ARUP Laboratories
130577815 Intron 4 Intronic SNV c.524-15C>T Benign 1 ARUP Laboratories
130577817 Exon 5 Large Deletion EX5del Deletion Exon 5 Pathogenic 2 Cymerman (2003)
ARUP Laboratories
130577817 Exon 5 Nonsense c.526C>T p.Glu176X Pathogenic 3 Olivieri (2007)
ARUP Laboratories
130577828 Exon 5 Deletion/Frameshift c.537_538delGT p.Ser180fs Pathogenic 1 Bossler (2006)
130577853 Exon 5 Insertion/Frameshift c.562_563insC p.Gln188fs Pathogenic 1 Cymerman (2003)
130577863 Exon 5 Missense c.572G>A p.Gly191Asp Benign 4 Lesca (2004)
Abdalla (2005)
Lenato (2006)
ARUP Laboratories
130577865 Exon 5 Deletion/Frameshift c.574delC p.Arg192fs Pathogenic 1 Olivieri (2007)
130577867 Exon 5 Deletion/Inframe c.576_596del21 p.Arg192_Pro198del Pathogenic 1 Shovlin (1997)
130577868 Exon 5 Insertion/Frameshift c.577_578insGC p.Thr193fs Pathogenic 1 Letteboer (2005)
130577868 Exon 5 Insertion/InFrame c.577_582delACGCTC
insGTACTCCAG
p.Thr193_L194
delinsVLQ
Pathogenic 1 Argyriou(2006)
130577871 Exon 5 Insertion/Frameshift c.580_581insACGC p.Leu194fs Pathogenic 2 Cymerman (2000)
ARUP Laboratories
130577871 Exon 5 Deletion/Inframe c.580_591del
TCGAGTGGCGGC
p.194_197del
LeuGluTryArg
Pathogenic 2 Gedge (2007)
ARUP Laboratories
130577871 Exon 5 Deletion/Frameshift c.580_596del17 p.LeuGluTrpArgPro
194_198delArg199fs
Pathogenic 1 ARUP Laboratories
130577872 Exon 5 Missense c.581T>C p.Leu194Pro Uncertain 1 Cymerman (2003)
130577877 Exon 5 Deletion/Frameshift c.586_604del
TGGCGGCCGCGTACTCCAG
p.Trp196fs Pathogenic 1 Abdalla (2005)
130577877 Exon 5 Missense c.586T>C p.Trp196Arg Pathogenic 1 Bayrak-Toydemir (2004)
Bayrak-Toydemir (2006)
130577878 Exon 5 Nonsense c.587G>A p.Trp196X Pathogenic 3 McAllister (1995)
Cymerman (2000)
Bossler (2006)
130577879 Exon 5 Nonsense c.588G>A p.Trp196X Pathogenic 2 Cymerman (2003)
ARUP Laboratories
130577881 Exon 5 Missense c.590G>A p.Arg197Gln 1 Abdalla (2005)  
130577881 Exon 5 Missense c.590G>C p.Arg197Pro 1 Olivieri (2007)  
130577882 Exon 5 Deletion/Frameshift c.591_619del29 p.Pro198fs Pathogenic 2 Lastella (2003)
Lenato (2006)
130577882 Exon 5 Deletion/Frameshift c.591delG p.Arg197fs Pathogenic 1 ARUP Laboratories
130577884 Exon 5 Missense c.593C>T p.Pro198Leu Pathogenic 2 ARUP Laboratories
130577887 Exon 5 Insertion/Frameshift c.596_597insCG p.Arg199fs Pathogenic 1 Bayrak-Toydemir (2004)
Bayrak-Toydemir (2006)
130577895 Exon 5 InDel/Frameshift c.604_607delinsCCC p.Ala202ProfsX20 Pathogenic 1 ARUP Laboratories
130577905 Exon 5 Missense c.614G>C p.Arg205Pro Uncertain 2 Gedge (2007)
ARUP Laboratories
130577908 Exon 5 Deletion/Frameshift c.617delG p.Gly206fs Pathogenic 1 ARUP Laboratories
130577910 Exon 5 Deletion/Inframe c.619_621delTGC p.Cys207del Pathogenic 1 Lesca (2004)
130577916 Exon 5 Intronic deletion c.625+110_130del21 Benign 1 ARUP Laboratories
130577917 Exon 5 Nonsense c.626T>A p.Leu209X Pathogenic 1 ARUP Laboratories
130577931 Exon 5 Deletion/Frameshift c.640_643delGGCC p.Gly214fs Pathogenic 2 Bayrak-Toydemir (2004)
Bayrak-Toydemir (2006)
Bossler (2006)
130577935 Exon 5 Deletion/Frameshift c.644delA p.His215fs Pathogenic 1 Argyriou(2006)
130577937 Exon 5 Missense c.646A>G p.Lys216Gln 2 ARUP Laboratories  
130577938 Exon 5 Deletion/Frameshift c.647delA p.Lys216fs Pathogenic 1 Bossler (2006)
130577944 Exon 5 Insertion/Frameshift c.653insC p.His219fs Pathogenic 1 Bossler (2006)
130577948 Exon 5 Deletion/Frameshift c.657_658delCA p.Ile220fs Pathogenic 1 Bourdeau (2000)
130577950 Exon 5 Missense c.659_660TC>AT Complex Uncertain 2 Gedge (2007)
ARUP Laboratories
130577950 Exon 5 Missense c.659T>A p.Ile220Asn Pathogenic 2 Gedge (2007)
ARUP Laboratories
130577950 Exon 5 Missense c.659T>C p.Ile220Thr Pathogenic 4 Bossler (2006)
Gedge (2007)
ARUP Laboratories
130577953 Exon 5 Missense c.662T>C p.Leu221Pro Pathogenic 5 Pece-Barbara (1999)
Schulte (2005)
Kuehl (2005)
Bossler (2006)
Gedge (2007)
ARUP Laboratories
130577965 Exon 5 Missense c.674C>T p.Pro252Leu Uncertain 1 ARUP Laboratories
130577973 Exon 5 Deletion/Frameshift c.682_686delTCGGC p.Ser228fs Pathogenic 1 Harrison (2003)
130577977 Intron 5 Intronic SNV c.689+99T>A Benign 1 ARUP Laboratories
130577980 Intron 5 Intronic insertion c.689+67_68insC Benign 2 ARUP Laboratories
130577980 Intron 5 Intronic deletion c.689+1_689+17del Benign 1 ARUP Laboratories
130577980 Intron 5 Splice Defect c.689+2T>C Pathogenic 2 Lesca (2004),Letteboer (2005)
130577980 Intron 5 Intronic insertion c.689+66_67insC Benign 1 ARUP Laboratories
130577981 Intron 5 Splice Defect c.690-1G>A Pathogenic 1 Argyriou(2006)
130577981 Intron 5 Splice Defect c.690-2A>T Pathogenic 1 Cymerman (2000)
130577985 Exon 6 Deletion/Inframe c.694_699delCGGACG p.Arg232_Thr233del Pathogenic 2 Lesca (2004)
ARUP Laboratories
130577992 Exon 6 Insertion/Frameshift c.701_702insACGG p.Val234fs Pathogenic 1 Letteboer (2005)
130577995 Exon 6 Deletion/Frameshift c.704delC p.Thr235fs Pathogenic 1 Schulte (2005)
130578004 Exon 6 Missense c.713T>A p.Val238Glu Uncertain 1 ARUP Laboratories
130578006 Exon 6 Insertion/Frameshift c.715_716insG p.Glu239fs Pathogenic 1 Prigoda (2006)
130578006 Exon 6 Nonsense c.715G>T p.Glu239X Uncertain 1 Abdalla (2005)
130578007 Exon 6 Insertion/Frameshift c.716_717dupG p.Glu239fs Pathogenic 1 Bossler (2006)
130578012 Exon 6 Deletion/Frameshift c.721_725delAGCTG p.Ser2411fs Pathogenic 1 ARUP Laboratories
130578017 Exon 6 Nonsense c.726C>A p.C242X Pathogenic 2 ARUP Laboratories
130578024 Exon 6 Deletion/Frameshift c.733delG p.Gly245fs Pathogenic 1 Letteboer (2005)
130578027 Exon 6 Deletion/Frameshift c.736delG p.Asp246fs Pathogenic 2 Cymerman (2003)
Bossler (2006)
130578029 Exon 6 Missense c.738T>A p.Asp246Gln 1 ARUP Laboratories  
130578031 Exon 6 Deletion/Frameshift c.740delT p.Asp248fs Pathogenic 1 Bossler (2006)
130578034 Exon 6 Deletion/Frameshift c.743delA p.Asp248fs Pathogenic 1 ARUP Laboratories
130578042 Exon 6 Deletion/Inframe c.751_753delCTC p.Leu251del 1 Wehner (2006)  
130578052 Exon 6 Insertion/Frameshift c.761_767dupAGGGTCC p.Pro257GlyfsX79 Pathogenic 1 ARUP Laboratories
130578055 Exon 6 Missense c.764G>A p.Gly255Asp Uncertain 1 ARUP Laboratories
130578055 Exon 6 Missense c.764G>T p.Gly255Val Uncertain 1 ARUP Laboratories
130578057 Exon 6 Insertion/Frameshift c.766_767insC p.Pro256fs Pathogenic 1 Letteboer (2005)
130578062 Exon 6 Insertion/Frameshift c.771_772insC p.Tyr258fs Pathogenic 1 ARUP Laboratories
130578062 Exon 6 Deletion/Frameshift c.771delC p.Pro257fs Pathogenic 3 Gedge (2007)
ARUP Laboratories
130578062 Exon 6 Insertion/Frameshift c.771dupC p.Tyr258fs Pathogenic 3 Lesca (2004)
Lenato (2006)
ARUP Laboratories
130578063 Exon 6 Insertion/Frameshift c.772_773insC p.Tyr258fs Pathogenic 1 Lesca (2004)
Bossler (2006)
130578063 Exon 6 Deletion/Frameshift c.772delT p.Tyr258fs Pathogenic 3 Fernandez (2006)
Olivieri (2007)
ARUP Laboratories
130578064 Exon 6 Deletion/Frameshift c.773_4delACGT
insGCAGGGTC
p.Tyr258fs Pathogenic 1 ARUP Laboratories
130578065 Exon 6 Nonsense c.774C>G p.Tyr258X Pathogenic 1 Olivieri (2007)
130578066 Exon 6 Deletion/Frameshift c.775delG p.Val259fs Pathogenic 1 Schulte (2005)
130578069 Exon 6 Missense c.778T>C p.Ser260Pro 1 Wehner (2006)  
130578071 Exon 6 Insertion/Frameshift c.780ins8 p.Ser260fs Pathogenic 1 Olivieri (2006)
130578072 Exon 6 Missense c.781T>C p.Trp261Arg 1 Letteboer (2005)  
130578073 Exon 6 Nonsense c.782G>A p.Trp261X Pathogenic 2 Paquet (2001)
Abdalla (2005)
130578076 Exon 6 Deletion/Frameshift c.785_789delTCATC p.Leu262fs Pathogenic 1 Lesca (2004)
130578078 Exon 6 Deletion/Inframe c.787_789delATC p.Ile263del 5 Lesca (2004)
Letteboer (2005)
Kuehl (2005)
Bossler (2006)
Lesca (2006)
 
130578079 Exon 6 Missense c.788T>C p.Ile263Thr 1 Lesca (2004)  
130578081 Exon 6 Missense c.790G>A p.Asp264Asn 1 Letteboer (2005)
Lenato (2006)
 
130578103 Exon 6 Missense c.812 T>A p.Ile271Asn 1 ARUP Laboratories  
130578106 Exon 6 Nonsense c.815G>A p.Trp272X Pathogenic 1 ARUP Laboratories
130578107 Exon 6 Nonsense c.816G>A p.Trp272X Pathogenic 2 ARUP Laboratories
130578107 Intron 6 Splice Defect c.816+2T>A Pathogenic 1 Lenato (2006)
130578107 Intron 6 Splice Defect c.816+2T>C Pathogenic 2 Schulte (2005)
Bossler (2006)
130578107 Intron 6 Splice Defect ? c.816+5G>C 1 Olivieri (2006)  
130578108 Intron 6 Intronic SNV c.817-79C>A Benign 1 ARUP Laboratories
130578108 Intron 6 Intronic Indel c.817_1134delinsTAAAC
(g.IVS6+140_IVS8+20>TAACC)
p.Thr273_Ala378del Pathogenic 1 Cymerman (2003)
130578108 Intron 6 Intronic deletion c.817-27delCT Benign 1 Gedge (2007)
130578108 Intron 6 Splice Defect c.817-2A>T Pathogenic 1 Lenato (2006)
130578108 Intron 6 Splice Defect ? c.817-7C>G 1 Prigoda (2006)  
130578110 Exon 7-8 Large Deletion EX7_8del Deletion Exon 7-8 Pathogenic 2 ARUP Laboratories
130578111 Exon 7 InDel/Frameshift c.820_826delACTGGAG
insTTGAAGGTCTTTCC
AGAGAAAAAC
p.Thr274fs Pathogenic 1 Cymerman (2000)
130578119 Exon 7 Insertion/Frameshift c.828_829insA p.Tyr277fs Pathogenic 1 Dakeishi (2002)
130578122 Exon 7 Nonsense c.831C>G p.Tyr277X Pathogenic 2 McAllister (1994)
Lastres (1994)
130578125 Exon 7 Deletion/Frameshift c.834_837delCTTC p.Phe279fs Pathogenic 1 Fernandez (2006)
130578125 Exon 7 Insertion/Frameshift c.834dupC p.Phe279fs Pathogenic 1 Fernandez (2006)
130578126 Exon 7 Deletion/Inframe c.835_837delTTC p.Phe279del Suspected Pathogenic 1 Wehner (2006)
130578163 Exon 7 Deletion/Inframe c.872_883del12 p.Lys291_Asp294
delLysLeuProAsp
Suspected Pathogenic 3 Gedge (2007)
ARUP Laboratories
130578166 Exon 7 Missense c.875T>A p.Leu292His Uncertain 2 ARUP Laboratories
130578169 Exon 7 Insertion/Frameshift c.878dupC p.Asp294fs Pathogenic 1 Wehner (2006)
130578173 Exon 7 Deletion/Inframe c.882_920del39 p.Thr295_Asn307del 2 McAllister (1994)
Lastres (1994)
 
130578178 Exon 7 InDel/Frameshift c.887_918del32,919_920
insCAAGCTCCCAG
p.Glu297fs Pathogenic 2 Letteboer (2005)
Lastres (1994)
130578180 Exon 7 Nonsense c.889C>T p.Gln297X Pathogenic 1 Lenato (2006)
130578181 Exon 7 Missense c.890A>C p.Gln297Pro Suspected Benign 1 ARUP Laboratories
130578184 Exon 7 Deletion/Frameshift c.893delG p.Gly298fs Pathogenic 1 Lesca (2004)
130578187 Exon 7 Deletion/Frameshift c.896del186 Pathogenic 1 Prigoda (2006)
130578190 Exon 7 Missense c.899T>C p.Leu300Pro Pathogenic 2 Gedge (2007)
ARUP Laboratories
130578195 Exon 7 Insertion/Frameshift c.904_905insGG p.Glu302fs Pathogenic 1 Cymerman (2003)
130578195 Exon 7 Nonsense c.904G>T p.Glu302X Pathogenic 1 ARUP Laboratories
130578196 Exon 7 Insertion/Frameshift c.905_906insG p.Glu302fs Pathogenic 2 ARUP Laboratories
130578200 Exon 7 Deletion/Inframe c.909_929del
CCGGATGCTCAATGCCAGCAT
p.Arg304_Ile310del 1 ARUP Laboratories  
130578208 Exon 7 Missense c.917T>C p.Leu306Pro 3 Gallione (1998)
Letteboer (2005)
Bossler (2006)
 
130578214 Exon 7 Missense c.923C>A p.Ala308Asp 2 Bossler (2006)
Prigoda (2006)
 
130578223 Exon 7 Missense c.932T>G p.Val311Gly Uncertain 1 Karabegovic (2004)
130578244 Exon 7 Insertion/Frameshift c.953_954insC p.Pro318fs Pathogenic 1 Prigoda (2006)
130578258 Exon 7 Deletion/Frameshift c.967_968delGT p.Val323fs Pathogenic 1 Fernandez (2006)
130578258 Exon 7 Insertion/Frameshift c.967_968insT p.Val323fs Pathogenic 4 Shovlin (1997)
Harrison (2003)
Bayrak-Toydemir (2006)
Gedge (2007)
130578273 Exon 7 Insertion/Frameshift c.982_983insGCCT p.Ser328fs Pathogenic 1 Prigoda (2006)
130578282 Exon 7 Missense c.991G>A p.Gly331Ser Pathogenic 4 Letteboer (2005)
Bossler (2006)
Gedge (2007)
ARUP Laboratories
130578282 Intron 7 Intronic insertion c.991+21_6insCCTCCC Benign 1 ARUP Laboratories
130578282 Intron 7 Intronic insertion c.991+25_26insCCTCCC Benign 2 Lesca (2004)
Lenato (2006)
130578282 Intron 7 Splice Defect c.991+2T>G Pathogenic 1 Bossler (2006)
130578282 Intron 7 Intronic SNV c.991+58A>T Benign 1 ARUP Laboratories
130578283 Intron 7 Splice Defect c.992-1G>A Pathogenic 2 Lesca (2006)
Gedge (2007)
130578283 Intron 7 Large Deletion c.992-25_1120del152 Pathogenic 1 Lesca (2004)
130578283 Intron 7 Splice Defect c.992-2A>G Pathogenic 1 ARUP Laboratories
130578284 Exon 8 Large Deletion EX8del Deletion Exon 8 Pathogenic 1 ARUP Laboratories
130578284 Exon 8 Deletion/Frameshift c.993_1134del p.Gly332fs Pathogenic 1 Shovlin (1997)
130578286 Exon 8 Deletion/Frameshift c.995delG p.Gly332fs Pathogenic 2 Letteboer (2005)
Gedge (2007)
130578288 Exon 8 Deletion/Frameshift c.997_1001delAGGCT p.Arg333fs Pathogenic 1 ARUP Laboratories
130578301 Exon 8 Nonsense c.1010C>G p.Ser337X Pathogenic 1 Olivieri (2007)
130578310 Exon 8 Missense c.1019C>T p.Pro340Leu Suspected Benign 1 ARUP Laboratories
130578320 Exon 8 Silent c.1029C>T p.Thr343Thr Benign 12 Shovlin (1997)
Lesca (2004)
Lenato (2006)
ARUP Laboratories
130578339 Exon 8 Insertion/Frameshift c.1048_1049dupTT p.Thr349fs Pathogenic 1 Lesca (2004)
130578341 Exon 8 Nonsense c.1050T>A p.Cys350X Pathogenic 4 McAllister (1994)
McAllister (1995)
Pece (1997)
Letteboer (2005)
130578346 Exon 8 Missense c.1055C>T p.Pro352Leu 1 Lastella (2003)  
130578351 Exon 8 Silent c.1060C>T p.Leu354Leu Benign 9 ARUP Laboratories
130578367 Exon 8 Missense c.1076T>C p.Ile359Thr Pathogenic 2 ARUP Laboratories
130578369 Exon 8 Nonsense c.1078C>T p.Gln360X Pathogenic 2 Letteboer (2005)
ARUP Laboratories
130578371 Exon 8 Deletion/Frameshift c.1080_1083delGACA p.Gln360fs Pathogenic 5 Gallione (1998)
Kuehl (2005)
Wehner (2006)
Bossler (2006)
Olivieri (2007)
ARUP Laboratories
130578376 Exon 8 Deletion/Frameshift c.1085delA p.Lys362fs Pathogenic 1 Wehner (2006)
130578378 Exon 8 Missense c.1087T>A p.Cys363Ser Pathogenic 2 Bossler (2006)
Gedge (2007)
130578379 Exon 8 Missense c.1088G>A p.Cys363Tyr 2 Paquet (2001)
Bossler (2006)
 
130578380 Exon 8 Deletion/Frameshift c.1089_1090delTG p.Ala363fs Pathogenic 1 Cymerman (2000)
130578386 Exon 8 Silent c.1095C>T p.Asp365Asp Benign 1 ARUP Laboratories
130578387 Exon 8 Missense c.1096G>C p.Asp366His Benign 6 Lastella (2003)
Lin (2001)
Lesca (2004)
Abdalla (2005)
Lin (2000)
Lenato (2006)
ARUP Laboratories
130578388 Exon 8 Deletion/Frameshift c.1097_1119del23 p.Asp366fs Uncertain 1 Lenato (2006)
130578389 Exon 8 Insertion/Frameshift c.1098_1099insT p.Ala367fs Pathogenic 1 Lenato (2006)
130578394 Exon 8 Missense c.1103T>C p.Met368Thr 1 ARUP Laboratories  
130578399 Exon 8 Insertion/Frameshift c.1108_1109insC p.Leu370fs Pathogenic 1 ARUP Laboratories
130578400 Exon 8 Missense c.1109T>C p.Leu370Pro Uncertain 1 ARUP Laboratories
130578402 Exon 8 Insertion/Frameshift c.1111_1112insG p.Val371fs Pathogenic 3 McAllister (1995)
Pece (1997)
Cymerman (2000)
130578402 Exon 8 Deletion/Frameshift c.1111_1133del23 p.Val371fs Pathogenic 2 Lesca (2004)
Bayrak-Toydemir (2004)
130578408 Exon 8 Insertion/Frameshift c.1117_1118insT p.Lys373fs Pathogenic 1 Letteboer (2005)
130578410 Exon 8 Deletion/Inframe c.1119_1121delGAA p.K374del Uncertain 2 ARUP Laboratories
130578411 Exon 8 Deletion/Frameshift c.1120_1123delAAAG p.Lys374fs Pathogenic 1 Dakeishi (2002)
130578412 Exon 8 Missense c.1121_1122AA>GC complex Pathogenic 2 Letteboer (2005)
Gedge (2007)
130578413 Exon 8 Insertion/Frameshift c.1122_1123insA p.Glu375fs Pathogenic 1 Cymerman (2003)
130578414 Exon 8 Nonsense c.1123G>T p.Glu375X Pathogenic 1 Abdalla (2005)
130578415 Exon 8 Deletion/Frameshift c.1124_1125delAG p.Leu375fs Pathogenic 1 Bossler (2006)
130578425 Exon 8 Splice Site/silent c.1134G>A p.Ala378Ala Pathogenic 4 Letteboer (2005)
Bossler (2006)
Olivieri (2007)
ARUP Laboratories
130578425 Intron 8 Intronic SNV c.1134+164C>T Benign 1 ARUP Laboratories
130578425 Intron 8 Intronic SNV c.1134+92G>A Benign 1 ARUP Laboratories
130578425 Intron 8 Intronic SNV c.1134+93G>T Benign 1 ARUP Laboratories
130578425 Intron 8 Insertion/InFrame c.1134_1135ins220_1134 p.Ala378_His379
insGly74_Ala373ext
Pathogenic 4 Shovlin (1997)
Bourdeau (2000)
Simon(2006)
Assis (2007)
130578425 Intron 8 Splice Defect c.1134+1G>A Pathogenic 2 Abdalla (2005)
Gedge (2007)
130578425 Intron 8 Intronic deletion c.1134+3_1134+8delAAGGGA 1 Lesca (2004)  
130578425 Intron 8 Intronic SNV c.1134+54C>T Benign 1 Gedge (2007)
130578426 Exon 9 Large Deletion EX9del Deletion Exon 9 Pathogenic 1 ARUP Laboratories
130578426 Exon 9-10 Large Deletion EX9_10del Deletion Exon 9-10 Pathogenic 11 Bossler (2006)
ARUP Laboratories
130578426 Exon 9-13 Large Deletion EX9_13del Deletion Exon 9-13 Pathogenic 3 Shovlin (1997)
Cymerman (2003)
Lesca (2006)
130578426 Exon 9-14c Large Deletion EX9_14cdel Deletion Exon 9-14c Pathogenic 3 ARUP Laboratories
130578433 Exon 9 Insertion/Frameshift c.1142_1143insT p.Lys381fs Pathogenic 1 Letteboer (2005)
130578435 Exon 9 Missense c.1144T>G p.Cys382Gly Uncertain 1 Olivieri (2007)
130578437 Exon 9 Nonsense c.1146C>A p.Cys382X Pathogenic 1 ARUP Laboratories
130578437 Exon 9 Missense c.1146C>G p.Cys382Trp 2 Bayrak-Toydemir (2004)
Bayrak-Toydemir (2006)
Bossler (2006)
 
130578457 Exon 9 Deletion/Inframe c.1166_1168delTCT p.Phe389del Pathogenic 2 Brusgaard (2004)
ARUP Laboratories
130578460 Exon 9 Nonsense c.1169G>A p.W390X Pathogenic 2 ARUP Laboratories
130578477 Exon 9 Deletion/Frameshift c.1186delG p.Ala396fs Pathogenic 1 Cymerman (2000)
130578481 Exon 9 Insertion/Frameshift c.1190_1191dupAG p.Asp398Argfs Pathogenic 2 Lenato (2006)
Giordano (2006)
130578486 Exon 9 Deletion/Frameshift c.1195delA p.Arg339fs Pathogenic 2 Bayrak-Toydemir (2004)
Bayrak-Toydemir (2006)
ARUP Laboratories
130578490 Exon 9 Deletion/Frameshift c.1199delG p.Gly400fs Pathogenic 1 Cymerman (2003)
Lesca (2004)
130578496 Exon 9 Deletion/Frameshift c.1205delA p.Lys402Serfs Pathogenic 1 ARUP Laboratories
130578497 Exon 9 Deletion/Frameshift c.1206delG p.Leu402fs Pathogenic 1 Gallione (1998)
130578499 Exon 9 Missense c.1208T>C p.Phe403Ser 1 ARUP Laboratories  
130578504 Exon 9 Insertion/Frameshift c.1213_1214ins11 p.Leu405fs Pathogenic 1 Lesca (2004)
130578511 Exon 9 Missense c.1220G>A p.Ser407Asn 2 Paquet (2001)
Wehner (2006)
 
130578522 Exon 9 Deletion/Inframe c.1231_1233delAGC p.Ser411del Pathogenic 1 Paquet (2001)
130578525 Exon 9 Missense c.1234T>A p.Cys412Ser 1 Lesca (2004)  
130578526 Exon 9 Missense c.1235G>A p.Cys412Tyr Uncertain 2 Gedge (2007)
ARUP Laboratories
130578529 Exon 9 Missense c.1238G>T p.Gly413Val 2 Gallione (2000)
Letteboer (2005)
 
130578534 Exon 9 Nonsense c.1243C>T p.Gln415X Pathogenic 1 Wehner (2006)
130578546 Exon 9 Deletion/Frameshift c.1255delA p.Ser419fs Pathogenic 1 Letteboer (2005)
130578558 Exon 9 Deletion/Frameshift c.1267delA p.Asn423fs Pathogenic 1 ARUP Laboratories
130578559 Exon 9 Missense c.1268A>G p.Asn423Ser 1 ARUP Laboratories  
130578559 Exon 9 Deletion/Frameshift c.1268delA p.Asn423fs Pathogenic 3 Gallione (1998)
Abdalla (2005)
Gedge (2007)
130578564 Intron 9 Splice Defect c.1273-1G>A Pathogenic 1 Kjeldsen (2005)
130578564 Intron 9 Splice Defect c.1273-1G>C Pathogenic 1 Bossler (2006)
130578564 Intron 9 Splice Defect c.1273-2A>G Pathogenic 1 Bossler (2006)
130578564 Intron 9 Splice Defect c.1273-4G>A Pathogenic 1 Prigoda (2006)
130578565 Exon 10 Missense c.1274 C>G p.Ala452Gly 1 ARUP Laboratories  
130578568 Exon 10 Missense c.1277T>G p.Val426Gly 1 ARUP Laboratories  
130578583 Exon 10 Nonsense c.1292C>A p.Ser431X Pathogenic 1 Bossler (2006)
130578597 Exon 10 Nonsense c.1306C>T p.Gln436X Pathogenic 2 Lenato (2006)
ARUP Laboratories
130578600 Exon 10 Missense c.1309C>T p.Arg437Trp Pathogenic 3 Bossler (2006)
Gedge (2007)
ARUP Laboratories
130578601 Exon 10 Deletion/Frameshift c.1310delG p.Arg437fs Pathogenic 1 Letteboer (2005)
130578601 Exon 10 Missense c.1310G>A p.Arg437Gln Pathogenic 1 ARUP Laboratories
130578602 Exon 10 Splice Site/silent c.1311G>A p.Arg437Arg 2 Letteboer (2005)
Bossler (2006)
 
130578602 Exon 10 Splice Site/silent c.1311G>C p.Arg437Arg 1 Gallione (1998)  
130578602 Exon 10 Splice Defect c.1311+1_2insG Pathogenic 1 Gedge (2007)
130578602 Exon 10 Splice Defect c.1311+2T>G Pathogenic 1 ARUP Laboratories
130578602 Exon 10 Intronic SNV c.1311+89C>T Benign 1 ARUP Laboratories
130578602 Intron 9b Splice Site/silent c.1311G>T p.Arg437Arg Suspected Pathogenic 1 ARUP Laboratories
130578602 Intron 9b Splice Defect c.1311+2T>A Pathogenic 1 Cymerman (2000)
130578602 Intron 9b Intronic SNV c.1311+47C>G Uncertain 1 Lesca (2004)
130578603 Exon 10-13 Large Deletion EX10_13del Deletion Exons 10-13 Pathogenic 1 ARUP Laboratories
130578603 Exon 10 Intronic SNV c.1312-66C>A Benign 1 ARUP Laboratories
130578606 Exon 10 Insertion/Frameshift c.1315_1322dupAAGGTGCA p.His441fs Pathogenic 1 Argyriou(2006)
130578608 Exon 10 Insertion/Frameshift c.1317_1318insA p.Val440fs Pathogenic 1 Letteboer (2005)
130578625 Exon 10 Deletion/Frameshift c.1334delT p.Met445Argfs Pathogenic 1 Harrison (2003)
130578633 Exon 10 Deletion/Frameshift c.1342_1343delCT p.Ser449fs Pathogenic 1 Cymerman (2003)
130578637 Exon 10 Deletion/Frameshift c.1346_1347delCT p.Ser449fs Pathogenic 4 Cymerman (2003)
Lesca (2004)
Letteboer (2005)
Schulte (2005)
Bayrak-Toydemir (2006)
130578638 Exon 10 Insertion/Frameshift c.1347_1348insCT p.Phe450fs Pathogenic 1 Prigoda (2006)
130578638 Exon 10 Deletion/Frameshift c.1347_1350delTTTC p.Phe450fs Pathogenic 2 Cymerman (2000)
Bossler (2006)
130578641 Exon 10 Insertion/Frameshift c.1350_1351insT p.Phe450fs Pathogenic 1 ARUP Laboratories
130578641 Exon 10 Nonsense c.1350C>T p.Gln451X Pathogenic 1 Bossler (2006)
130578652 Exon 10 Insertion/Frameshift c.1361_1362dupT p.Tyr455fs Pathogenic 1 Lesca (2004)
130578656 Exon 10 Nonsense c.1365C>A p.Tyr455X Pathogenic 1 ARUP Laboratories
130578665 Exon 10 Silent c.1374A>G p.Pro458Pro Benign 11 Bossler (2006)
Prigoda (2006)
ARUP Laboratories
130578683 Exon 10 Insertion/Frameshift c.1392_1393dupC p.Asn465fs Pathogenic 1 Lesca (2004)
130578687 Exon 10 Missense c.1396A>C p.Thr466Pro Suspected Pathogenic 1 ARUP Laboratories
130578698 Exon 10 Silent c.1407G>A p.Pro469Pro Benign 2 Gedge (2007)
ARUP Laboratories
130578701 Exon 10 Deletion/Frameshift c.1410delG p.Gly470fs Pathogenic 1 Lesca (2004)
130578705 Exon 10 Nonsense c.1414C>T p.Gln472X Pathogenic 3 McAllister (1995)
Pece (1997)
Bayrak-Toydemir (2006)
130578706 Exon 10 InDel/Frameshift c.1415_1417delAGAinsGT p.Gln472fs Pathogenic 3 Cymerman (2000)
Paquet (2001)
Gedge (2007)
130578719 Exon 10 Splice Site/silent c.1428G>A p.Gln476Gln 1 Lesca (2004)  
130578719 Exon 10 Splice Site/Missense c.1428G>C p.Gln476His 1 Wehner (2006)  
130578719 Intron 10 Splice Defect c.1428+1G>A Pathogenic 4 ARUP Laboratories
130578719 Intron 10 Splice Defect c.1428+2T>G Pathogenic 1 Bossler (2006)
130578720 Intron 10 Splice Defect c.1429-1G>A Pathogenic 4 Schulte (2005)
ARUP Laboratories
130578723 Exon 11 Deletion/Frameshift c.1432_1433delAG p.Arg478fs Pathogenic 3 Gallione (1998)
Letteboer (2005)
Schulte (2005)
130578736 Exon 11 Missense c.1445C>T p.Ala482Val Uncertain 1 Gedge (2007)
130578743 Exon 11 Silent c.1452C>T p.Ser484Ser Suspected Benign 2 ARUP Laboratories
130578760 Exon 11 Missense c.1469T>C p.Leu490Ser Uncertain 1 Bossler (2006)
130578760 Exon 11 Nonsense c.1469T>G p.Leu490X Pathogenic 1 Lesca (2004)
130578761 Exon 11 Insertion/Frameshift c.1470_1471dupA p.Asp491fs Pathogenic 1 ARUP Laboratories
130578761 Exon 11 Insertion/Frameshift c.1470_1471insA p.Asp491fs Pathogenic 6 Cymerman (2000)
Paquet (2001)
Lesca (2004)
Abdalla (2005)
Bossler (2006)
Gedge (2007)
130578761 Exon 11 Insertion/Frameshift c.1470_1471insGGGTG p.Asp491fs Pathogenic 1 Gedge (2007)
130578763 Exon 11 Deletion/Frameshift c.1472_1475delACAG p.Asp491fs Pathogenic 1 ARUP Laboratories
130578767 Exon 11 Insertion/Frameshift c.1476insC p.Cys493fs Pathogenic 1 Gedge (2007)
130578769 Exon 11 Deletion/Frameshift c.1478delG p.Ser492fs Pathogenic 1 Olivieri (2006)
130578770 Exon 11 Deletion/Frameshift c.1479_1480delC p.H494fs Pathogenic 1 Gedge (2007)
130578800 Exon 11 Deletion/Frameshift c.1509delC p.Thr503 Pathogenic 1 ARUP Laboratories
130578801 Exon 11 Missense c.1510G>A p.Val504Met Suspected Benign 3 Lesca (2004)
Brusgaard (2004)
McDonald (2009)
130578804 Exon 11 Nonsense c.1513G>T p.Glu505X Pathogenic 1 Lenato (2006)
130578813 Exon 11 Nonsense c.1522C>T p.Gln508X Pathogenic 1 Lesca (2004)
130578817 Exon 11 Deletion/Frameshift c.1526delG p.Gly509fs Pathogenic 1 Schulte (2005)
130578841 Exon 11 Deletion/Frameshift c.1550_1551delTG p.Val517fs Pathogenic 2 McAllister (1995)
Olivieri (2007)
130578844 Exon 11 Deletion/Frameshift c.1553_1554delGC p.Ser518fs Pathogenic 2 McAllister (1994)
Lastres (1994)
130578845 Exon 11 Deletion/Frameshift c.1554_1555delCC p.Leu519fs Pathogenic 1 Bossler (2006)
130578874 Exon 11 Insertion/Frameshift c.1583_1584dupC p.Arg529fs Pathogenic 1 Bossler (2006)
130578876 Exon 11 Missense c.1585C>T p.Arg529Cys Uncertain 1 ARUP Laboratories
130578877 Exon 11 Missense c.1586G>A p.Arg529His Pathogenic 2 Bossler (2006)
Gedge (2007)
130578886 Exon 11 Missense c.1595T>C p.Phe532Ser Uncertain 2 Gedge (2007)
ARUP Laboratories
130578896 Exon 11 Deletion/Frameshift c.1605_1627del23 p.His535fs Pathogenic 1 ARUP Laboratories
130578900 Exon 11 Deletion/Frameshift c.1609delT p.Tyr537fs Pathogenic 1 Lesca (2004)
130578902 Exon 11 Nonsense c.1611C>A p.Tyr537X Pathogenic 1 Letteboer (2005)
130578914 Exon 11 Insertion/Frameshift c.1623_1624dupA p.Pro542fs Pathogenic 1 Lesca (2004)
130578918 Exon 11 Insertion/Frameshift c.1627_1628dupCC p.Lys543fs Pathogenic 1 Bossler (2006)
130578921 Exon 11 Deletion/Frameshift c.1630delA p.Thr544fs Pathogenic 1 Abdalla (2005)
130578925 Exon 11 Missense c.1634G>A p.Gly545Asp Uncertain 2 Argyriou(2006)
ARUP Laboratories
130578931 Exon 11 Missense c.1640T>C p.Leu547Pro Pathogenic 1 Bossler (2006)
130578931 Exon 11 Missense c.1640T>G p.Leu547Arg Pathogenic 1 ARUP Laboratories
130578937 Exon 11 Missense c.1646G>A p.Cys549Tyr Uncertain 2 ARUP Laboratories
130578946 Exon 11 Deletion/Frameshift c.1655delC p.Ala552fs Pathogenic 2 McAllister (1995)
Gallione (1998)
130578948 Exon 11 Deletion/Frameshift c.1657delC p.Leu553fs Pathogenic 2 McAllister (1995)
ARUP Laboratories
130578962 Exon 11 Silent c.1671C>T p.Thr557Thr Benign 2 ARUP Laboratories
130578963 Exon 11 Deletion/Frameshift c.1672_1684del
GGGTCTCAAGACC
p.Gln558fs Pathogenic 1 Paquet (2001)
130578963 Exon 11 Insertion/Frameshift c.1672_1684dup13 p.Gln562fs Pathogenic 1 Olivieri (2007)
130578969 Exon 11 Nonsense c.1678C>T p.Gln560X Pathogenic 1 Letteboer (2005)
130578975 Exon 11 Nonsense c.1684C>T p.Gln562X Pathogenic 1 Letteboer (2005)
130578977 Exon 11 Intronic SNV c.1686+99T>A Benign 1 ARUP Laboratories
130578977 Intron 11 Splice Defect c.1686+1delG Pathogenic 1 ARUP Laboratories
130578977 Intron 11 Splice Defect c.1686+2T>C Pathogenic 1 Lenato (2006)
130578977 Intron 11 Splice Defect ? c.1686+3A>G Uncertain 1 ARUP Laboratories
130578977 Intron 11 Splice Defect ? c.1686+5G>C Uncertain 1 ARUP Laboratories
130578978 Intron 12 Splice Defect ? c.1687-7C>T 1 ARUP Laboratories  
130578978 Intron 12 Splice Defect c.1687-2A>G Pathogenic 1 Wehner (2006)
130578978 Exon 12 Large Duplication c.1687-?_1741+?dup Duplication Exon 12 Uncertain 1 Bossler (2006)
130578978 Exon 12 Deletion/Frameshift c.1687delG p.Glu563LysfsX10 Pathogenic 2 Bossler (2006)
ARUP Laboratories
130578978 Exon 12 Nonsense c.1687G>T p.Glu563X Pathogenic 1 ARUP Laboratories
130578980 Exon 12 Deletion/Frameshift c.1689_1699del
AGTCCATAGGA
p.Glu563fs Pathogenic 1 Paquet (2001)
130578989 Exon 12 Deletion/Frameshift c.1698delG p.Arg566fs Pathogenic 1 Bossler (2006)
130578998 Exon 12 Deletion/Frameshift c.1707delC p.Phe569fs Pathogenic 1 ARUP Laboratories
130579003 Exon 12 Deletion/Frameshift c.1712delG p.Arg571fs Pathogenic 1 Schulte (2005)
130579003 Exon 12 Missense c.1712G>A p.Arg571His Suspected Benign 5 ARUP Laboratories
130579006 Exon 12 Nonsense c.1715T>A p.Leu572X Pathogenic 1 Paquet (2001)
130579015 Exon 12 Missense c.1724T>C p.Ile575Thr 2 Lastella (2003)
Lenato (2006)
 
130579017 Exon 12 Missense c.1726A>G p.Ser576Gly Benign 1 ARUP Laboratories
130579021 Exon 12 Deletion/Frameshift c.1730_1731delCT p.Pro577X Pathogenic 2 ARUP Laboratories
130579024 Exon 12 Deletion/Frameshift c.1733_1737delACCTG p.Asp578fs Pathogenic 1 Bossler (2006)
130579032 Exon 12 Insertion/Frameshift c.1741_1742insTCTG p.Gly581fs Pathogenic 1 Abdalla (2005)
130579032 Intron 12 Splice Site/Missense c.1741G>A p.Gly581Ser 1 ARUP Laboratories  
130579032 Intron 12 Intronic SNV c.1741+79G>A Benign 1 ARUP Laboratories
130579032 Intron 12 Intronic SNV c.1741+35G>A Uncertain 1 ARUP Laboratories
130579033 Intron 12 Intronic SNV c.1742+35G>A Benign 1 ARUP Laboratories
130579033 Intron 12 Intronic SNV c.1742-72 C>T Benign 1 ARUP Laboratories
130579033 Intron 12 Intronic SNV c.1742-72 T>C Benign 1 ARUP Laboratories
130579033 Intron 12 Intronic SNV c.1742-31T>C Benign 1 Gedge (2007)
130579033 Intron 12 Intronic SNV c.1742-72T>C Benign 1 ARUP Laboratories
130579033 Exon 13-14 Large Deletion c.1742-?_1977+?del Deletion Exons 13-14 Pathogenic 1 ARUP Laboratories
130579085 Exon 13 Silent c.1794T>C p.Gly598Gly Benign 5 ARUP Laboratories
130579085 Exon 13 Silent c.1794T>G p.Gly598Gly Benign 1 Abdalla (2005)
130579102 Exon 14 Missense c.1811C>A p.Ala604Asp 1 Bossler (2006)  
130579135 Exon 14 Missense c.1844C>T p.Ser615Leu Suspected Benign 4 Kuehl (2005)
Bossler (2006)
Gedge (2007)
ARUP Laboratories
130579223 Exon 14 Silent c.1932C>T p. Ile644Ile Benign 12 Gedge (2007)
ARUP Laboratories