ENG Database

  • Reference sequences were NC_000009.10 and NM_001114753.1. cDNA #1 is the "A" of the start codon.
  • Frameshift is noted by original amino acid and codon number followed by "fs" (ex. Leu159fs).
  • Click any Column Header to sort the display. See Comments for additional variant information.
  • "Live Search" any term in the search box, such as "exon" , "missense", "benign" , "2010" , etc...
  • Clinical features/diagnostic criteria are: epistaxis (E), telangiectasia oral/dermal (T), pulmonary AVM (P), cerebral AVM (C), hepatic involvement (H), GI telangiectasia (G) and family history (F).

Click for a detailed description of Classification


525 variants found

( *Independent Observations )

Genomic Position Location Mutation
Type
Nucleotide
Change
Protein
Change
Classification Ind * Obs References Comments
Intron 11 Missense c.1689+3A > G 1 Fontalba (2008)  
Exon 5 Intronic deletion c.625+110_130del21 Benign 1 ARUP Laboratories
130578006 Exon 15 Silent c.1932C>T p. Ile644Ile Benign 12 Gedge (2007)
ARUP Laboratories
130578106 Intron 14 Deletion/inframe c.1853-21_1853-26delTCCCCG 1 Edinburgh (2013)  
130578230 Exon 14 Missense c.1844C>T p.Ser615Leu Benign 6 Kuehl (2005)
Bossler (2006)
Gedge (2007)
ARUP Laboratories
Edinburgh (2013)
130578263 Exon 14 Missense c.1811C>A p.Ala604Asp Suspected Pathogenic 2 Bossler (2006)
Edinburgh (2013)
130578280 Exon 14 Silent c.1794T>C p.Gly598Gly Benign 8 ARUP Laboratories
Edinburgh (2013)
130578280 Exon 14 Silent c.1794T>G p.Gly598Gly Benign 1 Abdalla (2005)
130578312 Exon 14 Missense c.1762G > A p.Val588Ile VUS 1 Edinburgh (2013)
130578312 Exon 14 Missense c.1762G > T p.Val588Phe VUS 1 Edinburgh (2013)
130578331 Intron 13 Intronic deletion c.1742-48_1743del Uncertain 1 Edinburgh (2013)
130578363 Intron 13 Intronic SNV c.1742-31T>C Benign 1 Gedge (2007)
130578404 Intron 13 Intronic SNV c.1742-72 T>C Benign 3 ARUP Laboratories
Edinburgh (2013)
130578404 Intron 13 Intronic SNV c.1742-72T>C Benign 2 ARUP Laboratories
Smoot (2009)
130579349 Intron 13 Intronic SNV c.1741+79G>A Benign 1 ARUP Laboratories
130579393 Intron 13 Intronic SNV c.1741+35G>A Uncertain 1 ARUP Laboratories
130579428 Exon 13 Duplication c.1738_1741dupTCTG p.Gly581Valfs*171 Pathogenic 1 Abdalla (2005)
130579428 Exon 13 Splice Site/Missense c.1741G>A p.Gly581Ser 1 ARUP Laboratories  
130579432 Exon 13 Deletion/Frameshift c.1733_1737delACCTG p.Asp578Valfs*171 Pathogenic 1 Bossler (2006)
130579438 Exon 13 Deletion/Frameshift c.1730_1731delCT p.Pro577Argfs*173 Pathogenic 2 ARUP Laboratories
130579443 Exon 13 Missense c.1726A>G p.Ser576Gly Benign 2 ARUP Laboratories
McDonald (2009)
130579445 Exon 13 Missense c.1724T>C p.Ile575Thr 2 Lastella (2003)
Lenato (2006)
 
130579448 Exon 13 Missense c.1721T > C 1 Edinburgh (2013)  
130579454 Exon 13 Nonsense c.1715T>A p.Leu572* Pathogenic 1 Paquet (2001)
130579457 Exon 13 Deletion/Frameshift c.1712delG p.Arg571Profs*2 Pathogenic 1 Schulte (2005)
130579457 Exon 13 Missense c.1712G>A p.Arg571His Suspected Benign 8 ARUP Laboratories
McDonald (2009)
130579462 Exon 13 Deletion/Frameshift c.1707delC p.Phe569Leufs*4 Pathogenic 1 ARUP Laboratories
130579470 Exon 13 Deletion/Frameshift c.1689_1699delAGTCCATAGGA p.Glu563Aspfs*12 Pathogenic 1 Paquet (2001)
130579471 Exon 13 Deletion/Frameshift c.1698delG p.Thr567Leufs*6 Pathogenic 2 Bossler (2006)
Nishida (2012)
130579482 Exon 13-14 Large Deletion c.1742-?_1977+?del Deletion Exons 13-15 Pathogenic 1 ARUP Laboratories
130579482 Exon 13 Deletion/Frameshift c.1687delG p.Glu563Lysfs*10 Pathogenic 2 Bossler (2006)
ARUP Laboratories
130579482 Exon 13 Nonsense c.1687G>T p.Glu563* Pathogenic 1 ARUP Laboratories
130579484 Intron 12 Splice Defect c.1687-2A>G Pathogenic 1 Wehner (2006)
130579489 Intron 12 Splice Defect c.1687-7C>T 1 ARUP Laboratories  
130580300 Intron 12 Intronic SNV c.1686+99T>A Benign 1 ARUP Laboratories
130580393 Intron 12 Intronic SNV c.1686+6T > C Uncertain 1 Edinburgh (2013)
130580394 Intron 12 Splice Defect c.1686+5G>C Uncertain 4 ARUP Laboratories
Fontalba (2008)
130580396 Intron 12 Splice Defect c.1686+3G>A Uncertain 1 ARUP Laboratories
130580396 Intron 12 Insertion c.1686+1insTCTG Pathogenic 1 IMPACT Genetics
130580397 Intron 12 Splice Defect c.1686+2T>C Pathogenic 1 Lenato (2006)
130580398 Intron 12 Splice Defect c.1686+1delG Pathogenic 2 ARUP Laboratories
Fontalba (2008)
130580398 Intron 12 Intronic SNV c.1742+35G>A Benign 1 ARUP Laboratories
130580401 Exon 12 Deletion/Frameshift c.1672_1684delGGGTCTCAAGACC p.Gly558Argfs*11 Pathogenic 1 Paquet (2001)
130580401 Exon 12 Insertion/Frameshift c.1672_1684dupGGGTCTCAAGACC p.Gln562Argfs*9 Pathogenic 1 Olivieri (2007)
130580401 Exon 12 Nonsense c.1684C>T p.Gln562* VUS 2 Letteboer (2005)
Edinburgh (2013)
130580407 Exon 12 Nonsense c.1678C>T p.Gln560* Pathogenic 1 Letteboer (2005)
130580414 Exon 12 Silent c.1671C>T p.Thr557Thr Benign 2 ARUP Laboratories
130580421 Exon 12 Duplication c.1661_1664dupGTCC p.Lys556Serfs*112 1 Nishida (2012)  
130580428 Exon 12 Deletion/Frameshift c.1657delC p.Leu553cysfs*20 Pathogenic 4 McAllister (1995)
Gallione (1998)
McAllister (1995)
ARUP Laboratories
130580439 Exon 12 Missense c.1646G>A p.Leu547Arg Uncertain 2 ARUP Laboratories
130580445 Exon 12 Missense c.1640T>C p.Leu547Pro Pathogenic 1 Bossler (2006)
130580445 Exon 12 Missense c.1640T>G p.Leu547Arg Pathogenic 1 ARUP Laboratories
130580451 Exon 12 Missense c.1634G>A p.Gly545Asp Uncertain 2 Argyriou(2006)
ARUP Laboratories
130580452 Exon 12 Missense c.1633G > A p.Gly545Ser 1 Edinburgh (2013)  
130580455 Exon 12 Deletion/Frameshift c.1630delA p.Thr544Profs*8 Pathogenic 1 Abdalla (2005)
130580458 Exon 12 Deletion/Frameshift c.1605_1627delCTTCACACAGTACCCATACCCA p.His535Glnfs*24 Pathogenic 1 ARUP Laboratories
130580459 Exon 12 Duplication c.1625-1626dupCC p.Lys543Profs*10 Pathogenic 1 Bossler (2006)
130580461 Exon 12 Insertion/Frameshift c.1623_1624dupA p.Pro542Hisfs*11 Pathogenic 1 Lesca (2004)
130580474 Exon 12 Nonsense c.1611C>A p.Tyr537* Pathogenic 1 Letteboer (2005)
130580476 Exon 12 Deletion/Frameshift c.1609delT p.Tyr537thrfs*15 Pathogenic 1 Lesca (2004)
130580490 Exon 12 Missense c.1595T>C p.Phe532Ser Uncertain 2 Gedge (2007)
ARUP Laboratories
130580499 Exon 12 Missense c.1586G>A p.Arg529His Pathogenic 3 Bossler (2006)
Gedge (2007)
Nishida (2012)
130580500 Exon 12 Missense c.1585C>T p.Arg529Cys Uncertain 1 ARUP Laboratories
130580502 Exon 12 Duplication c.1583dupC p.Arg529Alafs*38 Pathogenic 1 Bossler (2006)
130580502 Exon 12 Deletion/frameshift c.1582_1583delCC p.Pro528Alafs*38 Pathogenic 3 Edinburgh (2013)
130580530 Exon 12 Deletion/Frameshift c.1554_1555delCC p.Leu519Alafs*8 Pathogenic 1 Bossler (2006)
130580531 Exon 12 Deletion/Frameshift c.1553_1554delGC p.Ser518Thrfs*9 Pathogenic 2 McAllister (1994)
Lastres (1994)
130580534 Exon 12 Deletion/Frameshift c.1550_1551delTG p.Val517Glufs*10 Pathogenic 2 McAllister (1995)
Olivieri (2007)
130580559 Exon 12 Deletion/Frameshift c.1526delG p.Gly509Alafs*9 Pathogenic 1 Schulte (2005)
130580563 Exon 12 Nonsense c.1522C>T p.Gln508* Pathogenic 1 Lesca (2004)
130580572 Exon 12 Nonsense c.1513G>T p.Glu505* Pathogenic 1 Lenato (2006)
130580575 Exon 12 Missense c.1510G>A p.Val504Met Suspected Benign 3 Lesca (2004)
Brusgaard (2004)
McDonald (2009)
130580576 Exon 12 Deletion/Frameshift c.1509delC p.val504Trpfs*14 Pathogenic 1 ARUP Laboratories
130580584 Exon 12 Nonsense c.1501G > T p.Gly501* Pathogenic 1 IMPACT Genetics
130580589 Exon 12 Duplication c.1496dupC p.Glu500* Pathogenic 1 IMPACT Genetics
130580605 Exon 12 Deletion/Frameshift c.1480delC p.His494Thrfs*24 Pathogenic 1 Gedge (2007)
130580607 Exon 12 Deletion/Frameshift c.1478delG p.Cys493Serfs*25 Pathogenic 1 Olivieri (2006)
130580609 Exon 12 Duplication c.1476dupC p.Cys493Leufs*8 Pathogenic 1 Gedge (2007)
130580610 Exon 12 Deletion/Frameshift c.1472_1475delACAG p.Asp491alafs*26 Pathogenic 1 ARUP Laboratories
130580613 Exon 12 Insertion/Frameshift c.1470_1471insGGGTG p.Asp491Glyfs*29 Pathogenic 1 Gedge (2007)
130580615 Exon 12 Insertion/Frameshift c.1470dupA p.Asp491Argfs*10 Pathogenic 8 ARUP Laboratories
Cymerman (2000)
Paquet (2001)
Lesca (2004)
Abdalla (2005)
Bossler (2006)
Gedge (2007)
Edinburgh (2013)
130580616 Exon 12 Missense c.1469T>C p.Leu490Ser Uncertain 1 Bossler (2006)
130580616 Exon 12 Nonsense c.1469T>G p.Leu490* Pathogenic 1 Lesca (2004)
130580619 Exon 12 Deletion/frameshift c.1465_1466delCA p.gln489Valfs*11 1 Nishida (2012)  
130580633 Exon 12 Silent c.1452C>T p.Ser484Ser Suspected Benign 2 ARUP Laboratories
130580640 Exon 12 Missense c.1445C>T p.Ser482Phe Uncertain 1 Gedge (2007)
130580650 Exon 12 Deletion/Frameshift c.1434_1435delAG p.Arg478Serfs*22 Pathogenic 3 Gallione (1998)
Letteboer (2005)
Schulte (2005)
130580656 Exon 12 Large Duplication c.1687-?_1741+?dup Duplication Exon 13 Uncertain 1 Bossler (2006)
130580657 Intron 11 Splice Defect c.1429-1G>A Pathogenic 4 Schulte (2005)
ARUP Laboratories
130580665 Intron 11 Splice defect c.1429-9C > G Suspected Pathogenic 1 Edinburgh (2013)
130580993 Intron 11 Splice Defect c.1428+2T>G Pathogenic 1 Bossler (2006)
130580993 Intron 11 Splice defect c.1428+2T > C Pathogenic 1 Edinburgh (2013)
130580994 Intron 11 Splice Defect c.1428+1G>A Pathogenic 6 ARUP Laboratories
Nishida (2012)
130580995 Exon 11 Splice Site/silent c.1428G>A p.Gln476Gln 1 Lesca (2004)  
130580995 Exon 11 Splice Site/Missense c.1428G>C p.Gln476His 1 Wehner (2006)  
130581006 Exon 11 InDel/Frameshift c.1415_1417delinsGT p.Gln472Argfs*19 Pathogenic 3 Cymerman (2000)
Paquet (2001)
Gedge (2007)
130581009 Exon 11 Nonsense c.1414C>T p.Gln472* Pathogenic 4 McAllister (1995)
Pece (1997)
Bayrak-Toydemir (2006)
Fontalba (2008)
130581013 Exon 11 Deletion/Frameshift c.1410delG p.Gln471Serfs*20 Pathogenic 1 Lesca (2004)
130581016 Exon 11 Silent c.1407G>A p.Pro469Pro Benign 2 Gedge (2007)
ARUP Laboratories
130581025 Exon 11 Deletion/frameshift c.1398delC p.Ile467Serfs*24 Pathogenic 1 Edinburgh (2013)
130581027 Exon 11 Missense c.1396A>C p.Thr466Pro Suspected Pathogenic 1 ARUP Laboratories
130581031 Exon 11 Duplication c.1392dupC p.Asn46Glnfs*36 Pathogenic 1 Lesca (2004)
130581049 Exon 11 Silent c.1374A>G p.Pro458Pro Benign 13 Bossler (2006)
Prigoda (2006)
ARUP Laboratories
Edinburgh (2013)
130581058 Exon 11 Nonsense c.1365C>A p.Tyr455* Pathogenic 1 ARUP Laboratories
130581058 Exon 11 Nonsense c.1365C > T p.Tyr455Tyr 1 Fontalba (2008)  
130581062 Exon 11 Duplication c.1361dupT p.Tyr455Leu*46 Pathogenic 1 Lesca (2004)
130581072 Exon 11 Insertion/Frameshift c.1350_1351insT p.Gln451Serfs*50 Pathogenic 2 ARUP Laboratories
130581073 Exon 11 Deletion/Frameshift c.1347_1350delTTTC p.Phe450Serfs*40 Pathogenic 4 Cymerman (2000)
Bossler (2006)
Nishida (2012)
130581073 Exon 11 Nonsense c.1350C>T p.Phe450Phe Pathogenic 1 Bossler (2006)
130581076 Exon 11 Deletion/Frameshift c.1346_1347delCT p.Ser449Phefs*51 Pathogenic 6 Cymerman (2003)
Lesca (2004)
Letteboer (2005)
Schulte (2005)
Bayrak-Toydemir (2006)
Nishida (2012)
Edinburgh (2013)
130581076 Exon 11 Insertion/Frameshift c.1346_1347dupCT p.Phe450Leufs*42 Pathogenic 2 Prigoda (2006)
Lee (2011)
130581084 Exon 11 Frameshift c.1312_1341delinsCTGGGC p.Lys438_Ala658delins43 Pathogenic 1 Edinburgh (2013)
130581089 Exon 11 Deletion/Frameshift c.1334delT p.Met445Argfs*46 Pathogenic 1 Harrison (2003)
130581101 Exon 11 Insertion/Frameshift c.1315_1322dupAAGGTGCA p.His441Glnfs*53 Pathogenic 1 Argyriou(2006)
130581105 Exon 11 Insertion/Frameshift c.1317_1318insA p.Val440Serfs*61 Pathogenic 1 Letteboer (2005)
130581105 Exon 11 Missense c.1318G > A p.Val440Met Suspected Pathogenic 1 Edinburgh (2013)
130581114 Intron 10 Splice Site c.1312-3C > G Suspected Pathogenic 1 Edinburgh (2013)
130581177 Intron 10 Intronic SNV c.1312-66C>A Benign 1 ARUP Laboratories
130581812 Intron 10 Intronic SNV c.1311+89C>T Benign 1 ARUP Laboratories
130581896 Intron 10 Splice defect c.1311+5G > A Suspected Pathogenic 1 Edinburgh (2013)
130581899 Intron 10 Splice Defect c.1311+2T>A Pathogenic 1 Cymerman (2000)
130581899 Intron 10 Splice Defect c.1311+2T>G Pathogenic 4 ARUP Laboratories
Edinburgh (2013)
130581899 Intron 10 Splice defect c.1311+2T > C Suspected Pathogenic 1 Edinburgh (2013)
130581900 Intron 10 Splice Defect c.1311+1dupG Pathogenic 1 Gedge (2007)
130581900 Intron 10 Splice site c.1311+1G > A Pathogenic 1 IMPACT Genetics
130581901 Exon 10 Deletion/Frameshift c.1311delG p.Lys439Argfs*52 Pathogenic 1 Letteboer (2005)
130581901 Exon 10 Splice Site/silent c.1311G>A p.Arg437Arg 2 Letteboer (2005)
Bossler (2006)
 
130581901 Exon 10 Splice Site/silent c.1311G>C p.Arg437Arg 1 Gallione (1998)  
130581901 Exon 10 Splice Site/silent c.1311G>T p.Arg437Arg Suspected Pathogenic 1 ARUP Laboratories
130581902 Exon 10 Missense c.1310G>A p.Arg437Gln Pathogenic 1 ARUP Laboratories
130581903 Exon 10 Missense c.1309C>T p.Arg437Trp Pathogenic 4 Bossler (2006)
Gedge (2007)
ARUP Laboratories
Edinburgh (2013)
130581906 Exon 10 Nonsense c.1306C>T p.Gln436* Pathogenic 2 Lenato (2006)
ARUP Laboratories
130581914 Exon 10 Nonsense c.1298C > G p.Ser433* Pathogenic 1 Edinburgh (2013)
130581920 Exon 10 Nonsense c.1292C>A p.Ser431* Pathogenic 1 Bossler (2006)
130581935 Exon 10 Missense c.1277T>G p.Val426Ala 1 ARUP Laboratories  
130581938 Exon 10 Missense c.1274 C>G p.Ala452Gly 2 ARUP Laboratories
Fontalba (2008)
 
130581939 Exon 10-13 Large Deletion EX10_13del Deletion Exons 10-14 Pathogenic 1 ARUP Laboratories
130581940 Intron 9 Splice Defect c.1273-1G>A Pathogenic 1 Kjeldsen (2005)
130581940 Intron 9 Splice Defect c.1273-1G>C Pathogenic 1 Bossler (2006)
130581941 Intron 9 Splice Defect c.1273-2A>G Pathogenic 2 Bossler (2006)
ARUP Laboratories
130581943 Intron 9 Splice Defect c.1273-4G>A Pathogenic 1 Prigoda (2006)
130582169 Intron 9 Intronic SNV c.1272+10G > A VUS 1 Edinburgh (2013)
130582183 Exon 9 Deletion/Frameshift c.1268delA p.Asn423Metfs*68 Pathogenic 9 ARUP Laboratories
Gallione (1998)
Abdalla (2005)
Gedge (2007)
Edinburgh (2013)
130582183 Exon 9 Missense c.1268A>G p.Asn423Ser 1 ARUP Laboratories  
130582196 Exon 9 Deletion/Frameshift c.1255delA p.Ser419Valfs*2 Pathogenic 1 Letteboer (2005)
130582208 Exon 9 Nonsense c.1243C>T p.Gln415* Pathogenic 1 Wehner (2006)
130582213 Exon 9 Missense c.1238G>T p.Gly413Val 2 Gallione (2000)
Letteboer (2005)
 
130582216 Exon 9 Missense c.1235G>A p.Cys412Tyr Uncertain 2 Gedge (2007)
ARUP Laboratories
130582217 Exon 9 Missense c.1234T>A p.Cys412Ser 1 Lesca (2004)  
130582218 Exon 9 Deletion/Inframe c.1231_1233delAGC p.Ser411del Pathogenic 1 Paquet (2001)
130582231 Exon 9 Missense c.1220G>A p.Ser407Asn 3 Paquet (2001)
Wehner (2006)
Nishida (2012)
 
130582231 Exon 9 Missense c.1220G > T p.Ser407Ile Suspected Pathogenic 1 Edinburgh (2013)
130582236 Exon 9 MIssense c.1215G > C p.Leu405Phe Suspected Pathogenic 2 Edinburgh (2013)
IMPACT Genetics
130582243 Exon 9 Missense c.1208T>C p.Phe403Ser 1 ARUP Laboratories  
130582245 Exon 9 Deletion/Frameshift c.1206delG p.Leu402Asnfs*19 Pathogenic 1 Gallione (1998)
130582246 Exon 9 Deletion/Frameshift c.1205delA p.Lys402Serfs*19 Pathogenic 1 ARUP Laboratories
130582252 Exon 9 Deletion/Frameshift c.1199delG p.Gly400Valfs*21 Pathogenic 1 Cymerman (2003)
Lesca (2004)
130582256 Exon 9 Deletion/Frameshift c.1195delA p.Arg339Glyfs*22 Pathogenic 4 Bayrak-Toydemir (2004)
Bayrak-Toydemir (2006)
ARUP Laboratories
Nishida (2012)
Edinburgh (2013)
130582260 Exon 9 Insertion/Frameshift c.1190_1191dupAG p.Asp398Argfs*24 Pathogenic 2 Lenato (2006)
Giordano (2006)
130582265 Exon 9 Deletion/Frameshift c.1186delG p.ala396Glnfs*25 Pathogenic 1 Cymerman (2000)
130582275 Exon 9 Nonsense c.1176delC p.Ser393Alafs*28 Pathogenic 1 Edinburgh (2013)
130582282 Exon 9 Nonsense c.1169G>A p.Trp390* Pathogenic 3 ARUP Laboratories
Fontalba (2008)
130582283 Exon 9 Deletion/Inframe c.1166_1168delTCT p.Phe389del Pathogenic 2 Brusgaard (2004)
ARUP Laboratories
130582305 Exon 9 Nonsense c.1146C>A p.Cys382* Pathogenic 1 ARUP Laboratories
130582305 Exon 9 Missense c.1146C>G p.Cys382Trp 2 Bayrak-Toydemir (2004)
Bayrak-Toydemir (2006)
Bossler (2006)
 
130582307 Exon 9 Missense c.1144T>G p.Cys382Gly Uncertain 1 Olivieri (2007)
130582308 Exon 9 Insertion/Frameshift c.1142_1143insT p.Lys381Asnfs*15 Pathogenic 1 Letteboer (2005)
130582316 Exon 9 Large Deletion EX9del Deletion Exon 10 Pathogenic 1 ARUP Laboratories
130582316 Exon 9-10 Large Deletion EX9_10del Deletion Exon 9-10 Pathogenic 11 Bossler (2006)
ARUP Laboratories
130582316 Exon 9-13 Large Deletion EX9_13del Deletion Exon 9-13 Pathogenic 3 Shovlin (1997)
Cymerman (2003)
Lesca (2006)
130582316 Exon 9-14c Large Deletion EX9_14cdel Deletion Exon 9-14c Pathogenic 3 ARUP Laboratories
130582316 Exon 9 Insertion/Frameshift c.1213_1214ins11 p.Leu405fs Pathogenic 1 Lesca (2004)
130586149 Intron 8 Intronic SNV c.1134+164C>T Benign 1 ARUP Laboratories
130586490 Intron 8 Intronic SNV c.1134+93G>T Benign 2 ARUP Laboratories
130586491 Intron 8 Intronic SNV c.1134+92G>A Benign 1 ARUP Laboratories
130586529 Intron 8 Intronic SNV c.1134+54C>T Benign 1 Gedge (2007)
130586574 Intron 8 Intronic deletion c.1134+3_1134+8delAAGGGA 1 Lesca (2004)  
130586582 Intron 8 Splice Defect c.1134+1G>A Pathogenic 2 Abdalla (2005)
Gedge (2007)
130586583 Exon 8 Deletion/Frameshift c.993_1134delTGGTAGGCTGCAGACCTCACCCGCACCGATCCAGACCACTCC p.Gly332Ilefs*2 Pathogenic 1 Shovlin (1997)
130586583 Exon 8 Deletion/Frameshift c.1112_1134delTACTAAAGAAAGAGCTTGTTGC p.Val371Alafs*17 Pathogenic 2 Lesca (2004)
Bayrak-Toydemir (2004)
130586583 Exon 8 Splice Site/silent c.1134G>A p.Ala378Ala Pathogenic 4 Letteboer (2005)
Bossler (2006)
Olivieri (2007)
ARUP Laboratories
130586583 Exon 8 Splice site/silent c.1134G > A p.Ala378Ala Suspected Pathogenic 1 Edinburgh (2013)
130586583 Intron 8 Insertion/InFrame c.1134_1135ins220_1134 p.Ala378_His379
insGly74_Ala373ext
Pathogenic 4 Shovlin (1997)
Bourdeau (2000)
Simon(2006)
Assis (2007)
130586592 Exon 8 Deletion/Frameshift c.1124_1125delAG p.Glu375Alafs*20 Pathogenic 1 Bossler (2006)
130586593 Exon 8 Deletion/Frameshift c.1121_1124delAAGA p.Lys374Serfs*6 Pathogenic 1 Dakeishi (2002)
130586594 Exon 8 Nonsense c.1123G>T p.Glu375* Pathogenic 1 Abdalla (2005)
130586595 Exon 8 Missense c.1121_1122delinsGC p.Lys374Ser Pathogenic 2 Letteboer (2005)
Gedge (2007)
130586595 Exon 8 Duplication/frameshift c.1122dupA p.Glu375Aspfs*21 Pathogenic 3 Edinburgh (2013)
Cymerman (2003)
130586596 Exon 8 Deletion/Inframe c.1119_1121delGAA p.Lys374del Uncertain 2 ARUP Laboratories
130586597 Exon 8 Deletion/Frameshift c.1097_1119delACGCCATGACCCTGGTACTAAAG p.Arg366Glufs*22 Uncertain 1 Lenato (2006)
130586598 Exon 8 Deletion/frameshift c.1119delG p.Glu375Serfs*6 VUS 1 Edinburgh (2013)
130586599 Exon 8 Insertion/Frameshift c.1117_1118insT p.Lys373Ilefs*23 Pathogenic 1 Letteboer (2005)
130586606 Exon 8 Duplication c.1111dupG p.Val371Glyfs*25 Pathogenic 3 McAllister (1995)
Pece (1997)
Cymerman (2000)
130586608 Exon 8 Missense c.1109T>C p.Leu370Pro Uncertain 1 ARUP Laboratories
130586609 Exon 8 Duplication c.1108dup p.Leu370Profs*26 Pathogenic 1 ARUP Laboratories
130586613 Exon 8 Deletion c.1104delG p.Met368Ilefs*5 Pathogenic 1 IMPACT Genetics
130586614 Exon 8 Missense c.1103T>C p.Met368Thr 1 ARUP Laboratories  
130586618 Exon 8 Insertion/Frameshift c.1098_1099insT p.Ala367Cysfs*29 Pathogenic 1 Lenato (2006)
130586621 Exon 8 Missense c.1096G>C p.Asp366His Benign 6 Lastella (2003)
Lin (2001)
Lesca (2004)
Abdalla (2005)
Lin (2000)
Lenato (2006)
ARUP Laboratories
130586622 Exon 8 Silent c.1095C>T p.Asp365Asp Suspected Benign 2 ARUP Laboratories
Edinburgh (2013)
130586627 Exon 8 Deletion/Frameshift c.1089_1090delTG p.Ala364Argfs*31 Pathogenic 1 Cymerman (2000)
130586629 Exon 8 Missense c.1088G>A p.Cys363Tyr 2 Paquet (2001)
Bossler (2006)
 
130586630 Exon 8 Missense c.1087T>A p.Cys363Ser Pathogenic 3 Bossler (2006)
Gedge (2007)
Nishida (2012)
130586632 Exon 8 Deletion/Frameshift c.1085delA p.Lys362Serfs*7 Pathogenic 1 Wehner (2006)
130586634 Exon 8 Deletion/Frameshift c.1080_1083delGACA p.Thr361Serfs*7 Pathogenic 7 Gallione (1998)
Kuehl (2005)
Wehner (2006)
Bossler (2006)
Olivieri (2007)
ARUP Laboratories
Nishida (2012)
Lee (2011)
130586635 Exon 7 Deletion/Frameshift c.896_1082del p.Leu299Glnfs*8 Pathogenic 1 Prigoda (2006)
130586639 Exon 8 Nonsense c.1078C>T p.Gln360* Pathogenic 2 Letteboer (2005)
ARUP Laboratories
130586641 Exon 8 Missense c.1076T>C p.Ile359Thr Pathogenic 2 ARUP Laboratories
130586657 Exon 8 Silent c.1060C>T p.Leu354Leu Benign 9 ARUP Laboratories
130586662 Exon 8 Missense c.1055C>T p.Pro352Leu 1 Lastella (2003)  
130586667 Exon 8 Nonsense c.1050T>A p.Cys350* Pathogenic 4 McAllister (1994)
McAllister (1995)
Pece (1997)
Letteboer (2005)
130586669 Exon 8 Duplication c.1047_1048dupTT p.Cys350Phefs*10 Pathogenic 1 Lesca (2004)
130586688 Exon 8 Silent c.1029C>T p.Thr343Thr Benign 12 Shovlin (1997)
Lesca (2004)
Lenato (2006)
ARUP Laboratories
130586698 Exon 8 Missense c.1019C>T p.Pro340Leu Suspected Benign 1 ARUP Laboratories
130586707 Exon 8 Nonsense c.1010C>G p.Ser337* Pathogenic 1 Olivieri (2007)
130586716 Exon 8 Deletion/Frameshift c.997_1001delAGGCT p.Arg333Alafs*17 Pathogenic 1 ARUP Laboratories
130586718 Exon 8 Silent c.999G > A p.Arg333Arg Suspected Benign 1 Edinburgh (2013)
130586722 Exon 8 Deletion/Frameshift c.995delG p.Gly332Valfs*27 Pathogenic 2 Letteboer (2005)
Gedge (2007)
130586725 Exon 8 Large Deletion EX8del Deletion Exon 9 Pathogenic 1 ARUP Laboratories
130586726 Intron 7 Splice Defect c.992-1G>A Pathogenic 2 Lesca (2006)
Gedge (2007)
130586727 Intron 7 Splice Defect c.992-2A>G Pathogenic 1 ARUP Laboratories
130586728 Intron 7 Missense c.992-3C > G 1 Nishida (2012)  
130586750 Intron 7 Large Deletion c.992-25_1120del152 Pathogenic 1 Lesca (2004)
130587021 Intron 7 Intronic SNV c.991+58A>T Benign 1 ARUP Laboratories
130587052 Intron 7 Intronic insertion c.991+26_991+27insCTCCC Benign 2 Lesca (2004)
Lenato (2006)
130587056 Intron 7 Intronic insertion c.991+21_6insCCTCCC Benign 1 ARUP Laboratories
130587077 Intron 7 Splice Defect c.991+2T>G Pathogenic 1 Bossler (2006)
130587078 Intron 7 Splice Site c.991+1delG Pathogenic 1 IMPACT Genetics
130587079 Exon 7 Missense c.991G>A p.Gly331Ser Pathogenic 7 Letteboer (2005)
Bossler (2006)
Gedge (2007)
ARUP Laboratories
Nishida (2012)
McDonald (2009)
130587088 Exon 7 Duplication c.979_982dupGCCT p.Ser328Cysfs*7 Pathogenic 1 Prigoda (2006)
130587102 Exon 7 Deletion/Frameshift c.967_968delGT p.Val323Leufs*10 Pathogenic 1 Fernandez (2006)
130587102 Exon 7 Duplication c.968dupT p.Ser324Leufs*10 Pathogenic 4 Shovlin (1997)
Harrison (2003)
Bayrak-Toydemir (2006)
Gedge (2007)
130587117 Exon 7 Duplication c.953dupC p.Leu319Alafs*15 Pathogenic 1 Prigoda (2006)
130587138 Exon 7 Missense c.932T>G p.Val311Gly Uncertain 1 Karabegovic (2004)
130587141 Exon 7 Deletion/Inframe c.909_929delCCGGATGCTCAATGCCAGCAT p.Arg304_Ile310del 1 ARUP Laboratories  
130587147 Exon 7 Missense c.923C>A p.Ala308Asp Suspected Pathogenic 4 Bossler (2006)
Prigoda (2006)
Nishida (2012)
Edinburgh (2013)
130587150 Exon 7 Deletion/Inframe c.882_920delCACACCTCAAGGCCTCCTGGGGGAGGCCCGGATGCTCAA p.Thr295_Asn307del 2 McAllister (1994)
Lastres (1994)
 
130587152 Exon 7 InDel/Frameshift c.888_918delinsAAGCTCCCAG p.Gln297_Leu306delinsSerSerGln Pathogenic 2 Letteboer (2005)
Lastres (1994)
130587153 Exon 7 Missense c.917T>C p.Leu306Pro 3 Gallione (1998)
Letteboer (2005)
Bossler (2006)
 
130587155 Exon 7 Deletion/frameshift c.905_915delAGGCCGGATG p.Glu302Alafs*28 Pathogenic 1 Edinburgh (2013)
130587162 Exon 7 Missense c.908C > A p.Ala303Asp Uncertain 1 IMPACT Genetics
130587163 Exon 7 Insertion/Frameshift c.907dupG p.Ala303Glyfs*31 Pathogenic 2 ARUP Laboratories
130587166 Exon 7 Nonsense c.904G>T p.Glu302* Pathogenic 1 ARUP Laboratories
130587166 Exon 7 Duplication c.903_904dupGG p.Glu320Glyfs*58 Pathogenic 1 Cymerman (2003)
130587171 Exon 7 Missense c.899T>C p.Leu300Pro Suspected Pathogenic 4 Gedge (2007)
ARUP Laboratories
Edinburgh (2013)
130587177 Exon 7 Deletion/Frameshift c.893delG p.Gly298Alafs*61 Pathogenic 1 Lesca (2004)
130587180 Exon 7 Missense c.890A>C p.Gln297Pro Suspected Benign 1 ARUP Laboratories
130587181 Exon 7 Nonsense c.889C>T p.Gln297* Pathogenic 1 Lenato (2006)
130587187 Exon 7 Deletion/Inframe c.872_883delAGCTCCCAGACA p.Lys291_Asp294del Suspected Pathogenic 4 Gedge (2007)
ARUP Laboratories
Delaney (2012)
130587192 Exon 7 Insertion/Frameshift c.878dupC p.Asp294Argfs*40 Pathogenic 1 Wehner (2006)
130587195 Exon 7 Missense c.875T>A p.Leu292His Uncertain 2 ARUP Laboratories
130587206 Exon 7 Deletion/frameshift c.864delT p.Gly289Alafs*70 Pathogenic 1 Edinburgh (2013)
130587233 Exon 7 Deletion/Frameshift c.834_837delCTTC p.Phe279Arg*79 Pathogenic 1 Fernandez (2006)
130587233 Exon 7 Deletion/Inframe c.835_837delTTC p.Phe279del Suspected Pathogenic 1 Wehner (2006)
130587236 Exon 7 Insertion/Frameshift c.834dupC p.Phe279Leufs*55 Pathogenic 1 Fernandez (2006)
130587239 Exon 7 Nonsense c.831C>G p.Tyr277* Pathogenic 2 McAllister (1994)
Lastres (1994)
130587242 Exon 7 Duplication c.828dupA p.Tyr277Ilefs*57 Pathogenic 1 Dakeishi (2002)
130587244 Exon 7 InDel/Frameshift c.820_826delinsTTGAAGGTCTTTCC p.Thr274Leufs*62 Pathogenic 1 Cymerman (2000)
130587247 Exon 7 Frameshift c.822_823delTG p.Gly275Argfs*58 Pathogenic 1 Edinburgh (2013)
130587253 Intron 6 Intronic Indel c.817_1134delinsTAAAC
(g.IVS6+140_IVS8+20>TAACC)
p.Thr273_Ala378del Pathogenic 1 Cymerman (2003)
130587253 Exon 7-8 Large Deletion EX7_8del Deletion Exon 7-9 Pathogenic 2 ARUP Laboratories
130587254 Intron 6 Splice c.817-1G > T Pathogenic 1 Fodstad (2011)
130587255 Intron 6 Splice Defect c.817-2A>T Pathogenic 1 Lenato (2006)
130587256 Intron 6 Missense c.817-3T > G Pathogenic 1 Torring (2012)
130587260 Intron 6 Splice Defect ? c.817-7C>G 1 Prigoda (2006)  
130587279 Intron 6 Intronic deletion c.817-27_817-26delCT Benign 1 Gedge (2007)
130587332 Intron 6 Intronic SNV c.817-79C>A Benign 4 ARUP Laboratories
Edinburgh (2013)
130587505 Intron 6 Splice Defect ? c.816+5G>C 1 Olivieri (2006)  
130587508 Intron 6 Splice Defect c.816+2T>A Pathogenic 1 Lenato (2006)
130587508 Intron 6 Splice Defect c.816+2T>C Pathogenic 2 Schulte (2005)
Bossler (2006)
130587509 Intron 6 Splice defect c.816+1G > A Pathogenic 1 Edinburgh (2013)
130587510 Exon 6 Nonsense c.816G>A p.Trp272* Pathogenic 2 ARUP Laboratories
130587511 Exon 6 Nonsense c.815G>A p.Trp272* Pathogenic 1 ARUP Laboratories
130587514 Exon 6 Missense c.812 T>A p.Ile271Asn 2 ARUP Laboratories
Fontalba (2008)
 
130587521 Exon 6 Duplication/frameshift c.799_805dupCACAACA p.Met269Thrfs*67 Pathogenic 1 Edinburgh (2013)
130587536 Exon 6 Missense c.790G>A p.Asp264Asn 1 Letteboer (2005)
Lenato (2006)
 
130587537 Exon 6 Deletion/Frameshift c.785_789delTCATC p.Leu262Argfs*70 Pathogenic 1 Lesca (2004)
130587537 Exon 6 Deletion/Inframe c.787_789delATC p.Ile263del 5 Lesca (2004)
Letteboer (2005)
Kuehl (2005)
Bossler (2006)
Lesca (2006)
 
130587538 Exon 6 Missense c.788T>C p.Ile263Thr 1 Lesca (2004)  
130587544 Exon 6 Nonsense c.782G>A p.Trp261* Pathogenic 2 Paquet (2001)
Abdalla (2005)
130587545 Exon 6 Missense c.781T>C p.Trp261Arg 1 Letteboer (2005)  
130587548 Exon 6 Missense c.778T>C p.Ser260Pro 1 Wehner (2006)  
130587550 Exon 6 Deletion/Frameshift c.773_776delinsGCAGGGTC p.Try258Cycfs*77 Pathogenic 1 ARUP Laboratories
130587551 Exon 6 Deletion/Frameshift c.775delG p.Val259Cysfs*100 Pathogenic 1 Schulte (2005)
130587552 Exon 6 Nonsense c.774C>G p.Tyr258* Pathogenic 1 Olivieri (2007)
130587553 Exon 6 Insertion/Frameshift c.772_773insC p.Try258Serfs*76 Pathogenic 1 Lesca (2004)
Bossler (2006)
130587554 Exon 6 Deletion/Frameshift c.772delT p.Try258Thrfs*101 Pathogenic 4 Fernandez (2006)
Olivieri (2007)
ARUP Laboratories
Nishida (2012)
130587555 Exon 6 Duplication C.771dupC p.Try258Leufs*76 Pathogenic 5 ARUP Laboratories
Lesca (2004)
Lenato (2006)
ARUP Laboratories
Fontalba (2008)
130587555 Exon 6 Deletion/Frameshift c.771delC p.Try258Thrfs*101 Pathogenic 3 Gedge (2007)
ARUP Laboratories
130587555 Exon 6 Duplication c.711dupC p.Tyr258Leufs*76 Pathogenic 1 Letteboer (2005)
130587562 Exon 6 Missense c.764G>A p.Gly255Asp Uncertain 1 ARUP Laboratories
130587562 Exon 6 Missense c.764G>T p.Gly255Val Uncertain 1 ARUP Laboratories
130587564 Exon 6 Insertion/Frameshift c.761_767dupAGGGTCC p.Pro257Glyfs*79 Pathogenic 1 ARUP Laboratories
130587566 Exon 6 Nonsense c.760C > T p.Gln254* Pathogenic 1 IMPACT Genetics
130587573 Exon 6 Deletion/Inframe c.751_753delCTC p.Leu251del 1 Wehner (2006)  
130587574 Exon 6 Missense c.752T > G p.Leu251Arg Uncertain 1 IMPACT Genetics
130587583 Exon 6 Deletion/Frameshift c.743delA p.Asp248Valfs*111 Pathogenic 1 ARUP Laboratories
130587586 Exon 6 Deletion/Frameshift c.740delT p.Leu247profs*112 Pathogenic 1 Bossler (2006)
130587588 Exon 6 Missense c.738T>A p.Asp246Gln 1 ARUP Laboratories  
130587590 Exon 6 Deletion/Frameshift c.736delG p.Asp246Ilefs*113 Pathogenic 3 Cymerman (2003)
Bossler (2006)
Edinburgh (2013)
130587590 Exon 6 Deletion/Frameshift c.733delG p.Gly245fs Pathogenic 1 Letteboer (2005)
130587600 Exon 6 Nonsense c.726C>A p.Cys242* Pathogenic 3 ARUP Laboratories
McDonald (2009)
130587601 Exon 6 Deletion/Frameshift c.721_725delAGCTG p.Ser241Argfs*91 Pathogenic 1 ARUP Laboratories
130587609 Exon 6 Insertion/Frameshift c.716_717insG p.Leu240thrfs*94 Pathogenic 1 Bossler (2006)
130587611 Exon 6 Duplication c.715dupG p.Glu239Glyfs*95 Pathogenic 2 Prigoda (2006)
Edinburgh (2013)
130587611 Exon 6 Nonsense c.715G>T p.Glu239* Uncertain 1 Abdalla (2005)
130587613 Exon 6 Missense c.713T>A p.Val238Glu Uncertain 1 ARUP Laboratories
130587622 Exon 6 Deletion/Frameshift c.704delC p.thr235Argfs*2 Pathogenic 1 Schulte (2005)
130587624 Exon 6 Insertion/Frameshift c.701_702insACGG p.Thr235Argfs*100 Pathogenic 1 Letteboer (2005)
130587627 Exon 6 Deletion/Inframe c.694_699delCGGACG p.Arg232_Thr233del Pathogenic 2 Lesca (2004)
ARUP Laboratories
130587636 Exon 6 Insertion/Frameshift c.780ins8 p.Ser260fs Pathogenic 1 Olivieri (2006)
130587637 Intron 5 Splice Defect c.690-1G>A Pathogenic 2 Argyriou(2006)
ARUP Laboratories
130587638 Intron 5 Splice Defect c.690-2A>T Pathogenic 3 Cymerman (2000)
Nishida (2012)
Edinburgh (2013)
130587875 Intron 5 Intronic SNV c.689+99C>A Benign 1 ARUP Laboratories
130587902 Intron 5 Duplication c.689+72dupC Benign 2 ARUP Laboratories
130587908 Intron 5 Duplication c.689+66dupC Benign 1 ARUP Laboratories
130587972 Intron 5 Splice Defect c.689+2T>C Pathogenic 2 Lesca (2004),Letteboer (2005)
130587977 Exon 5 Deletion/Frameshift c.682_686delTCGGC p.Ser228Argfs*104 Pathogenic 1 Harrison (2003)
130587989 Exon 5 Missense c.674C>T p.Pro225Leu Uncertain 2 ARUP Laboratories
McDonald (2009)
130588001 Exon 5 Missense c.662T>C p.Leu221Pro Pathogenic 7 Pece-Barbara (1999)
Schulte (2005)
Kuehl (2005)
Bossler (2006)
Gedge (2007)
ARUP Laboratories
Nishida (2012)
Edinburgh (2013)
130588001 Exon 5 Deletion/frameshift c.662delT p.Leu221Argfs*14 1 Nishida (2012)  
130588003 Exon 5 Missense c.659_660delinsAT p.Ile220Asn Uncertain 2 Gedge (2007)
ARUP Laboratories
130588004 Exon 5 Missense c.659T>A p.Ile220Ans Pathogenic 2 Gedge (2007)
ARUP Laboratories
130588004 Exon 5 Missense c.659T>C p.Ile220Thr Pathogenic 4 Bossler (2006)
Gedge (2007)
ARUP Laboratories
130588005 Exon 5 Deletion/Frameshift c.657_658delCA p.Ile220Profs*113 Pathogenic 1 Bourdeau (2000)
130588010 Exon 5 Duplication c.653dupC p.His219Alafs*115 Pathogenic 2 Bossler (2006)
Nishida (2012)
130588016 Exon 5 Deletion/Frameshift c.647delA p.Lys216Argfs*6 Pathogenic 1 Bossler (2006)
130588017 Exon 5 Missense c.646A>G p.Lys216Gln Suspected Pathogenic 4 ARUP Laboratories
Fontalba (2008)
Edinburgh (2013)
130588019 Exon 5 Deletion/Frameshift c.644delA p.His215Profs*7 Pathogenic 1 Argyriou(2006)
130588020 Exon 5 Deletion/Frameshift c.640_643delGGCC p.Gly214Thrfs*7 Pathogenic 2 Bayrak-Toydemir (2004)
Bayrak-Toydemir (2006)
Bossler (2006)
130588037 Exon 5 Nonsense c.626T>A p.Leu209* Pathogenic 1 ARUP Laboratories
130588041 Exon 5 Deletion/Frameshift c.594_622delGCCGCGTACTCCAGCCTTGGTCCGGGGCT p.Arg199Leufs125 Pathogenic 2 Lastella (2003)
Lenato (2006)
130588042 Exon 5 Deletion/Inframe c.619_621delTGC p.Cys207del Pathogenic 1 Lesca (2004)
130588043 Exon 5 Missense c.620G > A c.Cys207Tyr Suspected Pathogenic 1 Edinburgh (2013)
130588046 Exon 5 Deletion/Frameshift c.617delG p.Gly206Alafs*16 Pathogenic 1 ARUP Laboratories
130588049 Exon 5 Missense c.614G>C p.Arg205Pro Uncertain 2 Gedge (2007)
ARUP Laboratories
130588056 Exon 5 InDel/Frameshift c.604_607delinsCCC p.Ala202Profs*20 Pathogenic 4 ARUP Laboratories
Edinburgh (2013)
130588059 Exon 5 Deletion/Frameshift c.586_640delTGGCGGCCGCGTACTCCAG p.Trp196Profs*20 Pathogenic 1 Abdalla (2005)
130588065 Exon 5 Duplication c.595_596dupCG p.Thr200Valfs*23 Pathogenic 1 Bayrak-Toydemir (2004)
Bayrak-Toydemir (2006)
130588066 Exon 5 Deletion/frameshift c.578_596delCGCTCGAGTGGCGGCCGCG p.Thr193Ilefs*23 1 Nishida (2012)  
130588067 Exon 5 Deletion/Inframe c.576_596delCACGCTCGAGTGGCGGCCGCG p.Leu194_Thr200del Pathogenic 1 Shovlin (1997)
130588067 Exon 5 Deletion/Frameshift c.580_596delCTCGAGTGGCGGCCGCG p.Leu194Tyrfs*134 Pathogenic 1 ARUP Laboratories
130588070 Exon 5 Missense c.593C>T p.Pro198Leu VUS 3 ARUP Laboratories
McDonald (2009)
130588071 Exon 5 Deletion/Inframe c.581_592delCTCGAGTGGCGG p.Leu194_Arg197del Pathogenic 2 Gedge (2007)
ARUP Laboratories
130588072 Exon 5 Deletion/Frameshift c.591delG p.Pro198Argfs*24 Pathogenic 1 ARUP Laboratories
130588073 Exon 5 Missense c.590G>A p.Arg197Gln 1 Abdalla (2005)  
130588073 Exon 5 Missense c.590G>C p.Arg197Pro Suspected Pathogenic 2 Olivieri (2007)
Edinburgh (2013)
130588074 Exon 5 Missense c.589C > T p.Arg197Trp Uncertain 1 IMPACT Genetics
130588075 Exon 5 Nonsense c.588G>A P.Trp196* Pathogenic 2 Cymerman (2003)
ARUP Laboratories
130588076 Exon 5 Nonsense c.587G>A p.Trp196* Pathogenic 3 McAllister (1995)
Cymerman (2000)
Bossler (2006)
130588077 Exon 5 Missense c.586T>C p.Trp196Arg Pathogenic 1 Bayrak-Toydemir (2004)
Bayrak-Toydemir (2006)
130588081 Exon 5 Insertion/InFrame c.577_582delinsGTACTCCAG p.Thr193_Leu194delinsValLeuGln Pathogenic 1 Argyriou(2006)
130588082 Exon 5 Missense c.581T>C p.Leu194Pro Uncertain 1 Cymerman (2003)
130588083 Exon 5 Duplication c.577_580dupACGC p.Leu194Hisfs*141 Pathogenic 2 Cymerman (2000)
ARUP Laboratories
130588085 Exon 5 Insertion/Frameshift c.577_578insGC p.Thr193Serfs*30 Pathogenic 1 Letteboer (2005)
130588089 Exon 5 Deletion/Frameshift c.574delC p.Arg192alafs*30 Pathogenic 1 Olivieri (2007)
130588091 Exon 5 Missense c.572G>A p.Gly191Asp Suspected Benign 6 Lesca (2004)
Abdalla (2005)
Lenato (2006)
ARUP Laboratories
Edinburgh (2013)
130588099 Exon 5 Insertion/Frameshift c.562_563insC p.Gln188Hisfs*146 Pathogenic 1 Cymerman (2003)
130588125 Exon 5 Deletion/Frameshift c.537_538delGT p.Ser180Leufs*153 Pathogenic 1 Bossler (2006)
130588137 Exon 5 Nonsense c.526C>T p.Gln176* Pathogenic 3 Olivieri (2007)
ARUP Laboratories
130588139 Exon 5 Large Deletion EX5del Deletion Exon 6 Pathogenic 2 Cymerman (2003)
ARUP Laboratories
130588140 Intron 4 Splice Defect c.524-1G>A Pathogenic 3 ARUP Laboratories
130588141 Intron 4 Splice Defect c.524-2A>G Pathogenic 5 Gallione (1998)
Bayrak-Toydemir (2006)
Gedge (2007)
ARUP Laboratories
130588154 Intron 4 Intronic SNV c.524-15C>T Benign 1 ARUP Laboratories
130588789 Exon 4 Missense c.523G>A p.Ala175Thr Suspected pathogenic 2 Bossler (2006)
130588789 Exon 4 Splice Site/Missense c.523G>C p.Ala175Pro Pathogenic 1 Cymerman (2003)
130588801 Exon 4 Nonsense c.511C>T p.Arg171* Pathogenic 14 Shovlin (1997)
Lastella (2003)
Lesca (2004)
Berg (2003)
Fernandez (2005)
Sanz-Rodriguez (2004)
Lenato (2006)
Bayrak-Toydemir (2006)
Fernandez (2006)
Bossler (2006)
ARUP Laboratories
Lee (2011)
Edinburgh (2013)
130588811 Exon 4 Deletion/frameshift c.494_501delCCCAGAGC p.Pro165Hisfs*166 Pathogenic 1 Edinburgh (2013)
130588814 Exon 4 Insertion/Frameshift c.497_498insC p.Gln166Hisfs*168 Pathogenic 2 Letteboer (2005)
ARUP Laboratories
130588816 Exon 4 Deletion/Frameshift c.495_496delCC p.Gln166Glufs*167 Pathogenic 1 Olivieri (2007)
130588816 Exon 4 Deletion/Frameshift c.496delC p.Gln166Argfs*56 Pathogenic 3 Lesca (2004)
ARUP Laboratories
130588816 Exon 4 Insertion/Frameshift c.496dupC p.Gln166Profs*168 Pathogenic 1 Schulte (2005)
130588818 Exon 4 Missense c.494C>G p.Pro165Arg Uncertain 2 Gedge (2007)
ARUP Laboratories
130588818 Exon 4 Missense c.494C>T p.Pro165Leu Uncertain 1 Cymerman (2003)
130588819 Exon 4 Missense c.493C>T p.Pro165Ser Uncertain 1 ARUP Laboratories
130588833 Exon 4 Missense c.479C>A p.Ala160Asp 1 Yamaguchi (1997)
Paquet (2001)
 
130588834 Exon 4 Missense c.478G > C p.Ala160Pro Suspected Pathogenic 1 Edinburgh (2013)
130588838 Exon 4 Deletion/Frameshift c.471_472delCT p.ser158Cysfs*3 Pathogenic 3 Gedge (2007)
ARUP Laboratories
130588851 Exon 4 Deletion/Frameshift c.461delG p.Gly154Alafs*9 Pathogenic 1 Lesca (2004)
130588855 Exon 4 Deletion/frameshift c.457delA p.Arg153Glys*10 Pathogenic 1 Edinburgh (2013)
130588865 Exon 4 Nonsense c.447G>A p.Trp149* Uncertain 1 Bossler (2006)
130588865 Exon 4 Missense c.447G>C p.Trp149Cys Pathogenic 7 Gallione (1998)
Bourdeau (2000)
Bossler (2006)
ARUP Laboratories
Nishida (2012)
130588866 Exon 4 Missense c.446G>C p.Trp149Ser Uncertain 2 Gedge (2007)
ARUP Laboratories
130588890 Exon 4 Deletion/Frameshift c.422delT p.Phe141Serfs*22 Pathogenic 1 ARUP Laboratories
130588915 Exon 4 Nonsense c.397delG p.Val133Serfs*30 Pathogenic 1 Edinburgh (2013)
130588915 Exon 4 Duplication c.397dupG p.Val133Glyfs*16 Pathogenic 1 IMPACT Genetics
130588919 Exon 4 Silent c.393G > C p.Pro131Pro Suspected Benign 1 Edinburgh (2013)
130588920 Exon 4 Missense c.392C>T p.Pro131Leu Suspected benign 8 Cymerman (2003)
Letteboer (2005)
Abdalla (2005)
Brusgaard (2004)
Kjeldsen (2005)
Fernandez (2006)
ARUP Laboratories
Fontalba (2008)
Edinburgh (2013)
130588920 Exon 4 Deletion/Frameshift c.392delC p.Pro131Argfs*32 Pathogenic 2 Wehner (2006)
Edinburgh (2013)
130588924 Exon 4 Missense c.388C>A p.Pro130Thr Uncertain 1 Lenato (2006)
130588924 Exon 4 Missense c.388C > T p.Pro130Ser Suspected Benign 1 Edinburgh (2013)
130588938 Exon 4 Missense c.374T>A p.Val125Asp Suspected Pathogenic 3 Paquet (2001)
Bossler (2006)
Edinburgh (2013)
130588938 Exon 4 Missense c.374T>C p.Val125Ala Uncertain 1 ARUP Laboratories
130588942 Exon 4 Deletion/frameshift c.370delC p.Leu124Trpfs*39 Pathogenic 1 Edinburgh (2013)
130588951 Exon 4-6 Large Deletion c.361-?_816+?del Deletion Exon 4-6 Pathogenic 1 Bossler (2006)
130588951 Exon 4-7 Large Deletion EX4_7del Deletion Exon 4-7 Pathogenic 1 ARUP Laboratories
130588953 Intron 3 Splice Defect c.361-2A>C Pathogenic 1 Kjeldsen (2005)
130588953 Intron 3 Splice Defect c.361-2A>G Pathogenic 2 Shovlin (1997)
Brusgaard (2004)
130588965 Intron 3 Deletion c.361-14del188 Uncertain 1 IMPACT Genetics
130589042 Intron 3 Deletion c.361-91del 1 Shoukier(2008)  
130589060 Intron 3 Deletion/Frameshift c.361-109_361-113delTTCTC Pathogenic 1 Bossler (2006)
130591875 Intron 3 Intronic SNV c.360+91C>T Benign 2 ARUP Laboratories
130591945 Intron 3 Intronic SNV c.360+21C>T Benign 1 ARUP Laboratories
130591959 Intron 3 Splice Defect c.360+4_360+7delAGTG Pathogenic 3 ARUP Laboratories
Gedge (2007)
Olivieri (2007)
130591959 Intron 3 Splice defect c.360+4_360+7del Pathogenic 1 Edinburgh (2013)
130591961 Intron 3 Splice Defect ? c.360+5G>A Uncertain 1 ARUP Laboratories
130591961 Intron 3 Splice Defect ? c.360+5G>C Uncertain 2 Letteboer (2005)
Gedge (2007)
130591962 Intron 3 Splice Defect c.360+4A>G Pathogenic 1 Shovlin (1997)
130591962 Intron 3 Splice defect c.360+4A > G Pathogenic 2 Edinburgh (2013)
130591963 Intron 3 Duplication c.360+3dupG 1 Nishida (2012)  
130591965 Intron 3 Splice Defect c.360+1G>A Pathogenic 14 Pece (1997)
Cymerman (2000)
Cymerman (2003)
Letteboer (2005)
Bayrak-Toydemir (2004)
Schulte (2005)
Bayrak-Toydemir (2006)
Bossler (2006)
Olivieri (2007)
ARUP Laboratories
Kim(2011)
Nishida (2012)
130591965 Intron 3 Splice Defect c.360+1G>C Pathogenic 1 Dakeishi (2002)
130591965 Intron 3 Splice defect c.360+1del Pathogenic 1 Edinburgh (2013)
130591965 Intron 3 Splice Site c.360+1G > T pathogenic 1 IMPACT Genetics
130591965 Intron 3 Large Duplication c.361-?_1134+?dup Pathogenic 1 ARUP Laboratories
130591965 Intron 3 Large Deletion c.361-?_523+?del Deletion Exon 5 Pathogenic 1 Bossler (2006)
130591966 Exon 3 Nonsense c.360C>A p.Tyr120* Pathogenic 3 Brusgaard (2004)
Kjeldsen (2005)
ARUP Laboratories
130591966 Exon 3 Silent c.360C>T p.Tyr120Tyr Benign 1 ARUP Laboratories
130591982 Exon 3 Deletion/Frameshift c.344delC p.Pro115Hisfs*48 Pathogenic 1 Argyriou(2006)
130591988 Exon 3 Deletion/Frameshift c.332_338delCCCTGGG p.Ala111Glufs*50 Pathogenic 1 Letteboer (2005)
130591988 Exon 3 Deletion/Frameshift c.338delG p.Gly113Glufs*50 Pathogenic 1 Olivieri (2007)
130591995 Exon 3 Missense c.331G>A p.Ala111Thr Suspected Pathogenic 1 ARUP Laboratories
130591999 Exon 3 Deletion/Frameshift c.326_327delTC p.Leu109Pro*39 Pathogenic 1 Wehner (2006)
130592002 Exon 3 Insertion/Frameshift c.324dupT p.Leu109Serfs*40 Pathogenic 1 Schulte (2005)
130592006 Exon 3 Missense c.320T>G p.Leu107Arg 1 Lesca (2004)  
130592012 Exon 3 Missense c.314T>A p.Val105Asp 2 Bossler (2006)
Nishida (2012)
 
130592015 Exon 3 Deletion/Inframe c.309_311delCAG p.Ser104Lysfs*45 Pathogenic 1 Lenato (2006)
130592021 Exon 3 Deletion/Frameshift c.305delA p.Asn102Thrfs*61 Pathogenic 1 ARUP Laboratories
130592027 Exon 3 Deletion/Frameshift c.298_299delAG p.Ser100Cysfs*48 Pathogenic 1 ARUP Laboratories
130592036 Exon 3 Missense c.290T>G p.Leu97Arg Pathogenic 3 Gedge (2007)
ARUP Laboratories
130592039 Exon 3 Missense c.287T>C p.Leu96Pro Pathogenic 1 Lenato (2006)
130592049 Exon 3 Nonsense c.277C>T p.Arg93* Pathogenic 14 Cymerman (2000)
Letteboer (2005)
Brusgaard (2004)
Bossler (2006)
Lesca (2006)
Olivieri (2006)
Gedge (2007)
Olivieri (2007)
ARUP Laboratories
Nishida (2012)
Edinburgh (2013)
130592049 Exon 3 Deletion/Frameshift c.277delC p.Arg93Glufs*9 Pathogenic 1 Schulte (2005)
130592050 Exon 3 Insertion/Frameshift c.258_276dupGCAAAATGGCACCTGGCCC p.Arg93Alafs*62 Uncertain 1 Brusgaard (2004)
130592053 Exon 3 Nonsense c.273G > A p.Trp91* Pathogenic 1 IMPACT Genetics
130592056 Exon 3 Duplication c.270dupC p.Trp91Leufs*58 1 Edinburgh (2013)  
130592079 Exon 3 Nonsense c.247C>T p.Gln83* Pathogenic 1 Letteboer (2005)
130592092 Exon 3 Silent c.234G>A p.Leu78Leu Benign 1 ARUP Laboratories
130592097 Exon 3 Nonsense c.229C>T p.Gln77* Pathogenic 8 Lastella (2003)
Brusgaard (2004)
Abdalla (2003)
Bayrak-Toydemir (2004)
Zhang (2004)
Dakeishi (2002)
Sanz-Rodriguez (2004)
Lenato (2006)
Prigoda (2006)
130592101 Exon 3 Silent c.225G>A p.Pro75Pro Benign 2 ARUP Laboratories
130592102 Exon 3 Deletion/Frameshift c.224delC p.Pro75argfs*6 Pathogenic 1 ARUP Laboratories
130592106 Exon 3 Large Deletion EX3del Deletion Exon 3 Pathogenic 1 ARUP Laboratories
130592106 Exon 3 Large Duplication EX3dup Duplication Exon 4 Pathogenic 2 ARUP Laboratories
130592106 Exon 3-4 Large Deletion EX3_4del Deletion Exon 3-4 Pathogenic 1 ARUP Laboratories
130592106 Exon 3-8 Large Deletion EX3_8del Deletion Exon 3-8 Pathogenic 1 ARUP Laboratories
130592106 Exon 3 Large Deletion c.220-?_360+?del Deletion Exon 3 Pathogenic 1 Bossler (2006)
130592106 Exon 3 Nonsense c.273_274GC>AA p.Trp91X Pathogenic 2 ARUP Laboratories
130592108 Intron 2 Splice Defect c.220-2A>G Pathogenic 1 ARUP Laboratories
130605348 Intron 2 Intronic SNV c.219+25 G>T Benign 1 ARUP Laboratories
130605348 Intron 2 Intronic SNV c.219+25G>A Benign 1 Gedge (2007)
130605348 Intron 2 Intronic SNV c.219+25G>T Benign 1 ARUP Laboratories
130605349 Intron 2 Intronic SNV c.219+22_23CG>GA Benign 1 ARUP Laboratories
130605349 Intron 2 Intronic Indel c.219+22-23delCGinsGA Benign 1 Gedge (2007)
130605351 Intron 2 Intronic SNV c.219+22C>T Benign 1 Bossler (2006)
130605368 Intron 2 Splice Defect ? c.219+5G>A 1 ARUP Laboratories  
130605368 Intron 2 Splice Defect ? c.219+5G>C 1 Lesca (2006)  
130605373 Exon 2 Splice Site/Silent c.219G>A p.Thr73Thr Uncertain 3 Cymerman (2003)
Kuehl (2005)
Gedge (2007)
130605377 Exon 2 Deletion/Frameshift c.214_215delCC p.Pro72Asnfs*76 Pathogenic 2 ARUP Laboratories
Edinburgh (2013)
130605382 Exon 2 Deletion/Frameshift c.210delG p.Glu70Apsfs*11 Pathogenic 1 Olivieri (2007)
130605385 Exon 2 Silent c.207G>A p.Leu69Leu Benign 19 Shovlin (1997)
Lastella (2003)
Lesca (2004)
Lenato (2006)
ARUP Laboratories
130605385 Exon 2 Silent c.207G > A p.Leu60Leu Suspected Benign 5 Edinburgh (2013)
130605397 Exon 2 Insertion/Frameshift c.195dupT pVal66Cysfs*83 Uncertain 4 Lesca (2004)
Schulte (2005)
Lesca (2006)
Yan(2006)
130605412 Exon 2 Missense c.179-180CC>AA p.Ile61Thrfs*21 Uncertain 2 ARUP Laboratories
130605426 Exon 2 Nonsense c.166C>T p.Gln56* Pathogenic 3 Bossler (2006)
Argyriou(2006)
ARUP Laboratories
130605428 Exon 2 Deletion/Frameshift c.164delC p.Ala55Valfs*26 Pathogenic 1 ARUP Laboratories
130605433 Exon 2 Nonsense c.159C>A p.Cys53* Pathogenic 1 Letteboer (2005)
130605435 Exon 2 Missense c.157T>C p.Cys53Arg Pathogenic 4 Gallione (1998)
Pece-Barbara (1999)
Cymerman (2000)
Bayrak-Toydemir (2004)
Karabegovic (2004)
Bayrak-Toydemir (2006)
130605437 Exon 2 Missense c.155G>A p.Gly52Asp 3 Paquet (2001)
Harrison (2003)
Wehner (2006)
 
130605437 Exon 2 Missense c.155G>T p.Gly52Val 6 Pece (1997)
Gallione (1998)
Pece-Barbara (1999)
McDonald(2000)
 
130605438 Exon 2 Missense c.154G>C p.Gly52Arg 1 Wehner (2006)  
130605440 Exon 2 Deletion c.146_152delTCTCGAA p.Val49glyfs*30 Pathogenic 1 IMPACT Genetics
130605446 Exon 2 Deletion/frameshift c.144_146delinsAG p.Val49Aspfs*32 Pathogenic 1 Edinburgh (2013)
130605447 Exon 2 Missense c.145G>T p.Val49Phe Pathogenic 5 Lesca (2004)
Olivieri (2007)
ARUP Laboratories
Nishida (2012)
Edinburgh (2013)
130605450 Exon 2 Nonsense c.142C>T p.Gln48* Pathogenic 1 Letteboer (2005)
130605471 Exon 2 Nonsense c.121G>T p.Glu41* Pathogenic 1 Cymerman (2003)
130605471 Exon 2 Missense c.121G > A p.Glu41Lys VUS 2 Edinburgh (2013)
130605472 Exon 2 Silent c.120C>T p.Gly40Gly Suspected Benign 8 ARUP Laboratories
Edinburgh (2013)
130605477 Exon 2 Deletion/Frameshift c.115delA p.Arg39Glyfs*4 Pathogenic 2 Cymerman (2003)
ARUP Laboratories
130605481 Exon 2 Deletion/Frameshift c.111delC p.Glu38Argfs*5 Pathogenic 1 ARUP Laboratories
130605485 Exon 2 Deletion/Frameshift c.107delG p.Gly36Alafs*7 Pathogenic 1 Schulte (2005)
130605490 Exon 2 Deletion/Frameshift c.96_102delTCAGCCT p.Gln33Trpfs*8 Pathogenic 1 Olivieri (2007)
130605495 Exon 2 Nonsense c.97C>T p.Gln33* Pathogenic 2 Lenato (2006)
Olivieri (2007)
130605497 Exon 2 Missense c.95T>A p.Leu32His Pathogenic 2 Gedge (2007)
ARUP Laboratories
130605497 Exon 2 Missense c.95T>G p.Leu32Arg 5 Paquet (2001)
Lin (2000)
Bossler (2006)
Giordano (2006)
Gedge (2007)
 
130605502 Exon 2 Nonsense c.90T>A p.Cys30* Pathogenic 1 Berg (2003)
130605513 Exon 2 Deletion/Frameshift c.77delA p.Thr27Glnfs*16 Pathogenic 1 Olivieri (2007)
130605524 Exon 2 Splice Defect c.68G>A p.Ser23Asn Pathogenic 3 Shovlin (1997)
Fernandez (2005)
Fernandez (2006)
130605524 Exon 2-4 Large Duplication c.68-?_523+?dup Duplication Exons 2-4 Pathogenic 1 Prigoda (2006)
130605524 Exon 2-8 Large Duplication EX2_8dup Duplication Exon 2-8 Pathogenic 1 ARUP Laboratories
130605524 Exon 2-9 Large Deletion c.68-?_?del Deletion Exon 2-9 Pathogenic 1 Bossler (2006)
130605524 Exon 2-10 Large Deletion EX2_10 Deletion Exon 2-10 Pathogenic 1 Bossler (2006)
130605524 Exon 2 Insertion/Frameshift c.212_219+6del14bp p.Phe71fs Pathogenic 2 ARUP Laboratories
Fontalba (2008)
130605525 Intron 1 Splice Defect c.68-1G>A Pathogenic 2 Lesca (2004)
Bossler (2006)
130605542 Intron 1 Intronic SNV c.68-18C>A Benign 1 Bossler (2006)
130616520 Intron 1 Intronic SNV c.67+48G > A 1 Edinburgh (2013)  
130616543 Intron 1 Splice Defect c.67+25G>T Uncertain 2 Lastella (2003)
Lenato (2006)
130616563 Intron 1 Splice Defect c.67+5G>A Pathogenic 3 Prigoda (2006)
Shovlin (1997)
Cymerman (2003)
130616565 Intron 1 Splice Defect c.67+3A>T 1 Bossler (2006)  
130616566 Intron 1 Splice Defect c.67+2delT Pathogenic 2 ARUP Laboratories
130616566 Intron 1 Splice c.67+2T > G 1 Nishida (2012)  
130616567 Intron 1 Splice Defect c.67+14G>T Benign 1 ARUP Laboratories
130616567 Intron 1 Splice Defect c.67+1G>A Pathogenic 3 Gallione (2000)
Letteboer (2005)
Giordano (2006)
130616568 Exon 1 Deletion/Frameshift c.67delA p.Ser23Valfs*20 Pathogenic 2 ARUP Laboratories
130616568 Exon 1 Deletion c.1_67del Pathogenic 1 Edinburgh (2013)
130616568 Exon 1 Large Deletion c.-?_67+?del Deletion Exon 1 Pathogenic 2 Lesca (2006)
Bossler (2006)
130616568 Exon 1 Large Deletion c.-?_360+?del Deletion Exon 1 Pathogenic 1 ARUP Laboratories
130616568 Exon 1 Large Deletion EX1del Deletion Exon 1 Pathogenic 2 ARUP Laboratories
Argyriou (2008)
130616572 Exon 1 Deletion/Frameshift c.63delC p.Thr22Glnfs*21 Pathogenic 4 Lastella (2003)
Abdalla (2005)
Lenato (2006)
Giordano (2006)
130616584 Exon 1 Insertion/Frameshift c.41_51dupTGGCCAGCTGC p.Ser18Trpfs*29 Pathogenic 3 Gedge (2007)
ARUP Laboratories
Edinburgh (2013)
130616594 Exon 1 Missense c.41T>C p.Leu14Pro Pathogenic 1 ARUP Laboratories
130616598 Exon 1 Insertion/Frameshift c.24_34dupGGCTGTTGCCC p.Leu13Argfs*34 Pathogenic 2 Bayrak-Toydemir (2006)
Gedge (2007)
130616600 Exon 1 Missense c.35T>C p.Leu12Pro Uncertain 2 ARUP Laboratories
130616600 Exon 1 Missense c.35T>G p.Leu12Arg 1 ARUP Laboratories  
130616603 Exon 1 Missense c.32C>A p.Ala11Asp 1 Bossler (2006)  
130616612 Exon 1 Missense c.23T>C p.Leu8Pro Pathogenic 7 Lesca (2004)
Kjeldsen (2005)
Olivieri (2006)
El-Harith (2006)
ARUP Laboratories
McDonald (2009)
130616621 Exon 1 Missense c.14C>T p.Thr5Met Benign 10 Shovlin (1997)
Lastella (2003)
Abdalla (2005)
Lenato (2006)
ARUP Laboratories
Fontalba (2008)
130616624 Exon 1 Deletion c.11delG p.Gly4Alafs*39 Pathogenic 1 IMPACT Genetics
130616628 Exon 1 Missense c.7C>T p.Arg3Cys Suspected Pathogenic 4 ARUP Laboratories
Edinburgh (2013)
130616632 Exon 1 Missense c.3G>A p.Met1Ile 1 ARUP Laboratories  
130616633 Exon 1 Missense c.2T>C p.Met1Thr 4 Gallione (1998)
Cymerman (2000)
Bayrak-Toydemir (2006)
Giordano (2006)
 
130616633 Exon 1 Missense c.2T>G p.Met1Arg Pathogenic 4 Lesca (2004)
Berg (2003)
Lastres (1994)
ARUP Laboratories
130616634 Exon 1 Missense c.1A>G p.Met1Val Pathogenic 3 Letteboer (2005)
Lenato (2006)
Gedge (2007)
130616643 5'UTR Regulatory c.-9G>A Pathogenic (hypomorphic allele) 7 Gedge (2007)
ARUP Laboratories
ARUP Laboratories
Damjanovich (2011)
130616644 5'UTR Regulatory c.-10C>T Suspected Pathogenic 4 Bossler (2006)
ARUP Laboratories
Edinburgh (2013)
130616761 5'UTR Regulatory c.-127C > T Pathogenic 6 Kim (2011)
Damjanovich (2011)
ARUP Laboratories